View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10351_high_8 (Length: 241)
Name: NF10351_high_8
Description: NF10351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10351_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 179
Target Start/End: Original strand, 33492937 - 33493115
Alignment:
| Q |
1 |
gttgaattactaatcaaccaaatttagcaaaacaaaacgtgattttcaccatgagactcacaatcagaagccgaggcttgatcacttttaggtcaaaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33492937 |
gttgaattactaatcaaccaaatttagcaaaacaaaacgtgattttcaccatgagactcacaatcagaagccgaggcttgatcacttttaggtcaaaatg |
33493036 |
T |
 |
| Q |
101 |
catcagaaaaaggtgtgaaccctcgaattcgatcacaacattcaaaattcataaactagtaaatttaccaaattttacc |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33493037 |
catcagaaaaaggtgtgaaccctcgaattcgatcacaacattcaaaattcataaactagtaaatttaccaaattttacc |
33493115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University