View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10351_low_10 (Length: 242)
Name: NF10351_low_10
Description: NF10351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10351_low_10 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 17 - 242
Target Start/End: Complemental strand, 42956638 - 42956411
Alignment:
| Q |
17 |
aattatgtggtgccatttcatttcaccctagccccatattttttctaatgtaatatttaactatgaatgaaatgaactagttttgtctttgttnnnnnnn |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42956638 |
aattatgtggtgccatttcatttcaccctagccccatattttttctaatgtactatttaactatgaatgaaatgaactagttttgtctttgttaaaaaaa |
42956539 |
T |
 |
| Q |
117 |
nnn--gtaggatgtgtactatatacaatacacttttcttgtgttgttgctttcaaacgaagcagtgattaacatcagtaaaaaatcactcacataatctc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42956538 |
aaaaagtaggatgtgtactatatacaatacacttttcttgtgttgttgctttcaaacgaagcagtgattaacatcagtaaaaaatcacacacataatctc |
42956439 |
T |
 |
| Q |
215 |
tttaattatgaaaggaaaaaataagttt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
42956438 |
tttaattatgaaaggaaaaaataagttt |
42956411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University