View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10351_low_17 (Length: 209)
Name: NF10351_low_17
Description: NF10351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10351_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 16 - 163
Target Start/End: Complemental strand, 40182076 - 40181929
Alignment:
| Q |
16 |
aggttagagttcaacattctcaatcgctcagtaaacctaaacctagccgtgtgtgtgccgtttgtctccaaccgattctcactcgcaaactatatataag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40182076 |
aggttagagttcaacattctcaatcgctcagtaaacctaaacctagccgtgtgtgtgccgtctgtctccaaccgattctcactcgcaaactatatatatg |
40181977 |
T |
|
| Q |
116 |
aagatgtgggtgtcgtttgcagcaagatatggcaggaactacatcact |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40181976 |
cagatgtgggtgtcgtttgcagcaagatatggcaggaactacatcact |
40181929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University