View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10352_low_14 (Length: 216)
Name: NF10352_low_14
Description: NF10352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10352_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 12 - 176
Target Start/End: Original strand, 41368345 - 41368505
Alignment:
| Q |
12 |
gagaagaaaagtggtgaaatagtcaaggaatcacactgctctcgaggaaatggtctcttcatttgtttgcgggacacacagatagtgtcactctctcctt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41368345 |
gagaagaaaagtggtgaaatagtcaaggaatcacactgctctcgaggaaatggtctcttcatttgtttgcgggacacacagatagtgtcactctgtcctc |
41368444 |
T |
|
| Q |
112 |
ccatatatatcaaggccccctctccccctgcaactatgttgaatttatgcatgcagttgcaccat |
176 |
Q |
| |
|
|| | ||||||||| ||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41368445 |
cc--acatatcaagg-cccctct-cccctgcagctatgttgaatttatgcatgcagttgcaccat |
41368505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University