View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10352_low_8 (Length: 316)
Name: NF10352_low_8
Description: NF10352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10352_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 19 - 305
Target Start/End: Complemental strand, 36636043 - 36635757
Alignment:
| Q |
19 |
ttgatgactattgtcaccatcatgaaccttaacagctacaggaagagaaggaagatcatcccttaactcctcagaaataaatcctttataaacacttcca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36636043 |
ttgatgactattgtcaccatcatgaaccttaacagctacaggaagagaatgaagatcatcccttaactcctcagaaataaatcctttataaacacttcca |
36635944 |
T |
|
| Q |
119 |
aatccacctccccctaacacacgatccggtctaaaattcccagttattttctttagctcatcataagtgaatgcaatcaatggatttgcagctgagttat |
218 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36635943 |
aatccacctccccctaacacacgatctggtctaaaattcccagttattttctttagttcatcataagtgaatgcaatcaatggatttgcagctgagttat |
36635844 |
T |
|
| Q |
219 |
cacgtctaagatcttcaacttcttcaggattcgatggtaacttactatcatcgtgcctttctttcattgccacctggttttgttctt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36635843 |
cacgtctaagatcttcaacttcttcaggattcgatggtaacttactatcatcgtgcctttctttcattgccacctggttttgttctt |
36635757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University