View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10353_high_16 (Length: 205)

Name: NF10353_high_16
Description: NF10353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10353_high_16
NF10353_high_16
[»] chr5 (1 HSPs)
chr5 (93-189)||(38814350-38814446)


Alignment Details
Target: chr5 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 93 - 189
Target Start/End: Original strand, 38814350 - 38814446
Alignment:
93 gcagatatccatgagatatcaaaagggaattagcgttgaaatgctctcaatactttctagtgaattatagatcagcttgatattctcttttgtgcaa 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38814350 gcagatatccatgagatatcaaaagggaattagcgttgaaatgctctcaatactttctagtgaattatagatcagcttgatattctcttttgtgcaa 38814446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University