View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10353_low_14 (Length: 332)
Name: NF10353_low_14
Description: NF10353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10353_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 22 - 225
Target Start/End: Original strand, 29002443 - 29002646
Alignment:
| Q |
22 |
agtagtatataaaataaataataaatggtttgtagaaaaaatttagtaaactctaatgattgtcttgtctgttagaggggctttgggcctcttccagaga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29002443 |
agtagtatataaaataaataataaatggtttgtagaaaaaatttagtaaactctaatgattgtcttgtctgttagaggggctttgggcctcttccagaga |
29002542 |
T |
|
| Q |
122 |
tggagaagattagtcaaggtttcatgtttataccatggcttaatgatagggttgttcatgaatcgtgcttttgtggcggttctctgtgggtggtgttttg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29002543 |
tggagaagattagtcaaggtttcatgtttataccatggcttaatgatagggttgttcatgaatcgtgcttttgtggcggttctctgtgggtggtgttttg |
29002642 |
T |
|
| Q |
222 |
gtcc |
225 |
Q |
| |
|
|||| |
|
|
| T |
29002643 |
gtcc |
29002646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University