View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10353_low_16 (Length: 322)
Name: NF10353_low_16
Description: NF10353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10353_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 126 - 299
Target Start/End: Complemental strand, 32682854 - 32682681
Alignment:
| Q |
126 |
ttatgactacattaccaatgaatactttgatttgtgaatggtgggccctcccaatgaagaaatggtaagctctgaattgttctactccttccatattccc |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32682854 |
ttatgactacattaccaatgaatactttgatttgtgaatggtgccccctcccaatgaagaaatggtaagctctgaattattctactccttccatattccc |
32682755 |
T |
 |
| Q |
226 |
gacaaggccattcattttggtaaattcatccaagttgtcccttcccccaagatatagaatggaagtgtataaag |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32682754 |
gacaaggccattcattttggtaaattcatccaagttgtcccttcccccaagatatagaatggaagtgtataaag |
32682681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 13 - 94
Target Start/End: Complemental strand, 32682928 - 32682847
Alignment:
| Q |
13 |
atcatcagttttgaacttttcatcatatattggttgactagatatccctaatttgtaactttgcatgttatgacttatgact |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32682928 |
atcatcagttttgaacttttcatcatatattggttgactagatatccctaatttgtaactttgcatgttatgacttatgact |
32682847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University