View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10354_high_11 (Length: 238)
Name: NF10354_high_11
Description: NF10354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10354_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 45006309 - 45006531
Alignment:
| Q |
1 |
tctttatccatatttcaatactacaagaccaacggtcttgatttaagttcattaacgcattcaaaacatcgatagttgttcaatcaataccaaacacttt |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45006309 |
tctttttccatatttcaatactacaagaccaacgatctagatttaaattcattaacgcattcaaaacatcgatagttgttcaatcaataccaaacatttt |
45006408 |
T |
|
| Q |
101 |
agattcaagttcaatatttaaaattataaatgaagtatttannnnnnnaggccgtctaacatcgatgtctcaaatgcaaaatttccccgattgcagcaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
45006409 |
agattcaagttcaatatttaaaattataaatgacgtatttatttttttaggccgtctaacatcgatgtctcgaatgcgaaatttccccgattgcagcaaa |
45006508 |
T |
|
| Q |
201 |
tcctatttcctcaaaatcctttc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
45006509 |
tcctatttcctcaaaatcctttc |
45006531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University