View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10354_high_13 (Length: 228)
Name: NF10354_high_13
Description: NF10354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10354_high_13 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 3447687 - 3447459
Alignment:
| Q |
1 |
tagaggtctctaagccacaaaacagggattatccaaaagcatcacacaatccacttcggttgaaatcaatttgaggagtctaaaatgtaaaatctaatac |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3447687 |
tagaggtctctaagccacaaaacatggattattcaaaagcatcacacaatccacttcggttgagatcaatttgacgagtctaaaatgtaaaatctaatac |
3447588 |
T |
 |
| Q |
101 |
ataggctatcctcaaaattgatttcaaccg-aacaggtagcttgatgctttgatataacaactgaattttgattgttttgagtgcactttatgtcctaaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3447587 |
ttaggctatcctcaaaattgatttcaaccgaaacaggtagcttgatgctttgatataacaactgaattttgattgttttgagtgcactttatgtcctaaa |
3447488 |
T |
 |
| Q |
200 |
ctgttcctgcatttgaatgttttgattgt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3447487 |
ctgttcctgcatttgaatgttttgattgt |
3447459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University