View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10354_high_7 (Length: 249)
Name: NF10354_high_7
Description: NF10354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10354_high_7 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 5 - 249
Target Start/End: Complemental strand, 14369476 - 14369233
Alignment:
| Q |
5 |
gagaagcagagaataaactgaccctcacggtctctaaagacacctccagcagctgataaaccaggatttcccttggcagcaccatctatgttacatttga |
104 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14369476 |
gagaaacatagaataaactgaccctcacggtctctaaagacacctccagcagctgataaaccagggtttcccttggcagcaccatctatgttacatttga |
14369377 |
T |
 |
| Q |
105 |
tccaggaatggagaggagggtgccacatcacctctttgataatcggtgctctagggtggtgaacagaaacattaaaattcttgatcagggtaaagtctct |
204 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14369376 |
tc-aggaatggagaggagggtgccacatcacctctttgataatcggtgctctagggtggtgaacagaaacattaaaattcttgatcagggtaaagtctct |
14369278 |
T |
 |
| Q |
205 |
gattgaattagaagatgttttctttgttgtgtttcatgctagggc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14369277 |
gattgaattagaagatgttttctttgttgtgtttcatgctagggc |
14369233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University