View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10354_low_19 (Length: 232)
Name: NF10354_low_19
Description: NF10354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10354_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 2665123 - 2665344
Alignment:
| Q |
1 |
tttccccaattatcccccttgtccctgctacgcctgcacctgttgagccccctgtagacccttctgcccctattgttgcccctgttgagcctccggttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2665123 |
tttccccaattatcccccttgtccctgctacgcctgcacctgttgagccccctgtagacccttctgcccctattattgcccctgttgagcctccggttat |
2665222 |
T |
|
| Q |
101 |
tccaacattccccccattggatgtagctgctccttcttactcatcattgccactgcgccccgcttacatctctagaagattgatggctgttcacttttaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2665223 |
tccaacattccccccattggatgtagctgctccttcttactcatcattgccactgcgccccacttacatctctagaagattgatggctgttcacttttaa |
2665322 |
T |
|
| Q |
201 |
gtctcttgcaattgagcctatg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2665323 |
gtctcttgcaattgagcctatg |
2665344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University