View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10354_low_8 (Length: 277)
Name: NF10354_low_8
Description: NF10354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10354_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 13 - 263
Target Start/End: Complemental strand, 16357548 - 16357298
Alignment:
| Q |
13 |
gatctaccagatctttttcctgatggaaaaaatggaattctttcttattcttcttcttggcatttatgtgctgttgatagtggacttcgcctcgaggagc |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16357548 |
gatcttccagatctttttcctgatggaaaaaatggaattctttcttattattcttcttggcatttatgtgctgttgatagtggacttcgcctcgaggagc |
16357449 |
T |
|
| Q |
113 |
aactttcgtcatgggagtattactagcgtcatctttgatcgactgctatctgggctgcgacattgagctttttgtaactgtaggctccaactcgacctca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
16357448 |
aactttcgtcatgggagtattactagcgtcatctttgatcgactgctatctgggctgccacatcgagctttttgtaactgtaggctccaactcgacctca |
16357349 |
T |
|
| Q |
213 |
aattaatttgcatcatctacatttgacctcaattgttcgtagaattattct |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16357348 |
aattaatttgcatcatctacatttgacctcaattgttcgtagaattattct |
16357298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University