View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10354_low_9 (Length: 277)
Name: NF10354_low_9
Description: NF10354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10354_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 266
Target Start/End: Original strand, 2664663 - 2664895
Alignment:
| Q |
19 |
cctctccctctgtttcaaggttaatttatcttgcacagaaaaatgatcaaatttttagcattggtgttattattactccaactaatctttctcaccacat |
118 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2664663 |
cctctccctgtgtttcaaggttactttatcttgcacagaaaaatgatcaaatttttagcattggtgttattattactccaactaatctttctcaccacat |
2664762 |
T |
|
| Q |
119 |
ttgctcaagagcttgaaccggttctttatgaaaccgatggttttagatttaagccttttgtcccctctaagccttcccctgttaagccttttattccttc |
218 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2664763 |
ttgctcaagagcttgaacctgttctttatgaaaccgatggttttagatttaagccttttgtcccctc---------------taagccttttattccttc |
2664847 |
T |
|
| Q |
219 |
taagcctggcctttttaggcctaatccaatttccgtcgatgtccctat |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2664848 |
taagcctggcctttttaggcctaatccaatttccgtcgatgtccctat |
2664895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 135
Target Start/End: Complemental strand, 19262900 - 19262785
Alignment:
| Q |
20 |
ctctccctctgtttcaaggttaatttatcttgcacagaaaaatgatcaaatttttagcattggtgttattattactccaactaatctttctcaccacatt |
119 |
Q |
| |
|
|||||||||| ||||||||||| | | || | | ||||||||| ||||| | ||||||||| ||||| | ||||| ||||||| |||| |||| ||||| |
|
|
| T |
19262900 |
ctctccctctttttcaaggttactatctcctatagagaaaaatggtcaaaatcttagcattgttgttactcttacttcaactaacctttttcactacatt |
19262801 |
T |
|
| Q |
120 |
tgctcaagagcttgaa |
135 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
19262800 |
tgcggaagagcttgaa |
19262785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University