View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10355_low_4 (Length: 321)
Name: NF10355_low_4
Description: NF10355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10355_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 21 - 308
Target Start/End: Original strand, 6014064 - 6014351
Alignment:
| Q |
21 |
atccaaacaaaaactaaaacaaatccacgcattttccatacgtcacaatgtcccactcaacaaccccgacatcggaaaataccttattttcaccattgtt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6014064 |
atccaaacaaaaactaaaacaaatccacgcattttccatacgtcacaatgtcccactcaacaaccccgacatcggaaaataccttattttcaccattgtt |
6014163 |
T |
 |
| Q |
121 |
tccctctcagcaccaatgtcctacgctcacaacgttttcacattgttatataacccaaatgtttttacttggaacactatgattcgagggtacgctgaaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6014164 |
tccctctcagcaccaatgtcctacgctcacaacgttttcacattgttatataacccaaatgtttttacttggaacactatgattcgagggtacgctgaaa |
6014263 |
T |
 |
| Q |
221 |
gtgataactcaacacctgcacttggtttgtatcgtaaaatgttgggttcatgtgttgaacctgatactcacacttacccttttcttct |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6014264 |
gtgataactcaacacctgcacttggtttgtatcgtaaaatgttgggttcatgtgttgaacctgatactcacacttacccttttcttct |
6014351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University