View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10356_high_2 (Length: 226)
Name: NF10356_high_2
Description: NF10356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10356_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 6517658 - 6517868
Alignment:
| Q |
1 |
ttatggatgtttcaagctttaaaacgtgaacgagnnnnnnncattaaaaaataatttggccggctatatattcgtctgttgctagtttttaaaactattt |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6517658 |
ttattgatgtttcaagctttaaaacgtgaacgagtttttttcattaaaaaataatttggccggctatatattcgtctgttgctagtttttaaaactattt |
6517757 |
T |
|
| Q |
101 |
gaaacaaaatttcactttcctttttatagaagaaactaacctttcttagatggagaaacatcatataattaatatgcaatttctcatttctcccttaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6517758 |
gaaacaaaatttcactttcctttttatagaagaaactaacctttcttagatggagaaacatcatataattaatatgcaatttctcatttctcccttaata |
6517857 |
T |
|
| Q |
201 |
tgttagttttg |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
6517858 |
tgttagttttg |
6517868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 128
Target Start/End: Original strand, 6513335 - 6513420
Alignment:
| Q |
42 |
cattaaaaaataatttggccggctatatattcgtctgttgctagtttttaaaactatttgaaacaaaatttcactttcctttttata |
128 |
Q |
| |
|
|||| ||||| |||||||||||||||| ||||| || ||||||| ||||||||||| || || ||||||||||||||| |||||||| |
|
|
| T |
6513335 |
cattgaaaaagaatttggccggctatagattcgactattgctagcttttaaaacta-ttcaaccaaaatttcactttcgtttttata |
6513420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University