View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10357_low_6 (Length: 202)

Name: NF10357_low_6
Description: NF10357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10357_low_6
NF10357_low_6
[»] chr3 (1 HSPs)
chr3 (20-179)||(33169995-33170154)


Alignment Details
Target: chr3 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 20 - 179
Target Start/End: Complemental strand, 33170154 - 33169995
Alignment:
20 gtagacaggatcagaagatgttatacaaattattggttgatttcatgattatatcttacgcaaaactatataaattggaaaatgcaacactagaaacttc 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33170154 gtagacaggatcagaagatgttatacaaattattggttgatttcatgattatatcttacgcaaaactatataaattggaaaatgcaacactagaaacttc 33170055  T
120 aagnnnnnnnnnttacttcaatggtgtattggtcacaaataaccgattctcactgtcacg 179  Q
    |||          |||||||||||||||||||||||||||||||||||||| || |||||    
33170054 aaggaaaaaaaaatacttcaatggtgtattggtcacaaataaccgattctcgctatcacg 33169995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University