View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10358_high_2 (Length: 391)
Name: NF10358_high_2
Description: NF10358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10358_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 9e-83; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 9e-83
Query Start/End: Original strand, 29 - 204
Target Start/End: Original strand, 40689981 - 40690156
Alignment:
| Q |
29 |
caccgcgcgccggtgggaacatctgcagccaacactacactctctttgacaccaatggctttggaacctgatgaagatcatcctagaaagaaaaggaatg |
128 |
Q |
| |
|
||||| || ||||||||||| |||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40689981 |
caccgtgcaccggtgggaacttctgcagccaacaccacactctctttgacaacaatggctttggaacctgatgaagatcatcctagaaagaaaaggaatg |
40690080 |
T |
|
| Q |
129 |
ttttgtctttggatttggatctcaaccttcctgcacctgaagatgatcatagagaatctaagtttgcctttgcttc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40690081 |
ttttgtctttggatttggatctcaaccttcctgcacctgaagatgatcatagagaatctaagtttgcctttgcttc |
40690156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 286 - 370
Target Start/End: Original strand, 40690241 - 40690325
Alignment:
| Q |
286 |
tcttgtcttctctgcaccagctttggtggattgtcattactgagacaagtaacaaggttttggttttggattcaacatgatgatg |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40690241 |
tcttgtcttctctgcaccagctttggtggattgtcattactgagacaagtaacaaggttttggttttggattcaacatgatgatg |
40690325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 110 - 198
Target Start/End: Original strand, 34714363 - 34714448
Alignment:
| Q |
110 |
cctagaaagaaaaggaatgttttgtctttggatttggatctcaaccttcctgcacctgaagatgatcatagagaatctaagtttgcctt |
198 |
Q |
| |
|
||||||||||||| |||||| | ||||||||||||||||||||||||||||| || |||| ||||| ||||| | ||||||||||| |
|
|
| T |
34714363 |
cctagaaagaaaatgaatgtct---ctttggatttggatctcaaccttcctgcagcttaagaagatcaaagagagttcaagtttgcctt |
34714448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 135 - 186
Target Start/End: Original strand, 34710689 - 34710740
Alignment:
| Q |
135 |
ctttggatttggatctcaaccttcctgcacctgaagatgatcatagagaatc |
186 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||| ||||| |||||||| |
|
|
| T |
34710689 |
ctttggatttggatctcaaccttcctgcagcttaagaagatcaaagagaatc |
34710740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 286 - 359
Target Start/End: Original strand, 34710777 - 34710848
Alignment:
| Q |
286 |
tcttgtcttctctgcaccagctttggtggattgtcattactgagacaagtaacaaggttttggttttggattca |
359 |
Q |
| |
|
|||||| |||| |||||| |||| ||||||||||||||||| ||||||| |||| ||||| |||| ||||||| |
|
|
| T |
34710777 |
tcttgttttctgtgcacctgcttgggtggattgtcattact--gacaagtgacaaagttttagtttgggattca |
34710848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University