View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10359_high_4 (Length: 550)
Name: NF10359_high_4
Description: NF10359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10359_high_4 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 3e-86; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 331 - 550
Target Start/End: Complemental strand, 35354919 - 35354698
Alignment:
| Q |
331 |
gagttattttatgctgctttctttgcagtgnnnnnnn-----ttgtttttgctttcgatttgtgaaaaggatcttattaccgtctcttcttgtgtttgtg |
425 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35354919 |
gagttattttatgctgctttctttgcagtgaaaagaaaaaaattgtttttgctttcgatttgtgaaaaggatcttattaccgtctcttcttgtgtttgtg |
35354820 |
T |
|
| Q |
426 |
tgtacacgtgtaggttaataagagcattatggcttcaaatggtatattgggtaataagagaaaggcttcagaaagagatgaagttactgaagatgatggt |
525 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35354819 |
tgtacacatgtaggttgataagagcattatggcttcaaatggtatattgggtaataagagaaaggcttcagaaagagatgaagttactgaa---gatggt |
35354723 |
T |
|
| Q |
526 |
attgttcatatcgaatttggaatca |
550 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
35354722 |
attgttcatatcgaatttggaatca |
35354698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 35355266 - 35355161
Alignment:
| Q |
1 |
aaaatgattattctcttcgacttattgattaatggtttctttatacctttacacaagttaccttcactctcacgagacactacaaaaaccttagtattta |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35355266 |
aaaatgattattctcttcgacttattaattaatggtttctttataactttacacaagttaccttcactctcacgagacactacaaaaaccttagtattta |
35355167 |
T |
|
| Q |
101 |
ttttat |
106 |
Q |
| |
|
|||||| |
|
|
| T |
35355166 |
ttttat |
35355161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 261 - 291
Target Start/End: Complemental strand, 35354989 - 35354959
Alignment:
| Q |
261 |
atttgtttaatattatggttaatctcattgt |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35354989 |
atttgtttaatattatggttaatctcattgt |
35354959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University