View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1035_low_5 (Length: 356)
Name: NF1035_low_5
Description: NF1035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1035_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 319; Significance: 1e-180; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 1 - 347
Target Start/End: Original strand, 34880187 - 34880533
Alignment:
| Q |
1 |
cctaccaccagttccaaaccttcaatttgctcaccatacttctccatcaaaacttgctttgaaagagaattcacctcttgatgtagatgtcatttccact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34880187 |
cctaccaccagttccaaaccttcaatttgctcaccatacttctccatcaaaacttgctttgaaagagaattcacctcttgaagtagatgtcatttccact |
34880286 |
T |
|
| Q |
101 |
ttgtgagtagttgtagactcatattaaccaccctaacatctttcgccccaaacccctctaacttcttggttggcaaaccttcctccatttgacccaacaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34880287 |
ttgtgagtagttgtagactcatattaaccaccctaacatctttcgccccaaacccctctaacttcttggttggcaaaccttcctccatttgacccaacaa |
34880386 |
T |
|
| Q |
201 |
tttttgtgacttccttttgtgaaaattgacttccgaacctagcatcatttcgaatcctctcaataatgctttcaatgtccaaaattatccaccattggct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34880387 |
tttttgtgacttccttttgtgaaaattgacttccgaccctgacaccatttggaatcctctcaataatgctttcaatgtccaaaattatccaccattggct |
34880486 |
T |
|
| Q |
301 |
cccatatacatagagtatcatcgacgtattgcaaatgccatattatt |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34880487 |
cccatatacatagagtatcatcgacgtattgcaaatgcgatattatt |
34880533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 200
Target Start/End: Complemental strand, 36988012 - 36987975
Alignment:
| Q |
163 |
ttcttggttggcaaaccttcctccatttgacccaacaa |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
36988012 |
ttctaggttggcaaaccttcctccatttcacccaacaa |
36987975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University