View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1035_low_8 (Length: 285)
Name: NF1035_low_8
Description: NF1035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1035_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 7834572 - 7834650
Alignment:
| Q |
143 |
ttgaatgatattttagtaaaggtaccatttaaatatattgacattattatatatttagagtttaattacgataaactat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
7834572 |
ttgaatgatattttagtaaaggtaccatttaaatatattgacattattgtatatttagagtttaattgcgataaactat |
7834650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University