View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10362_high_5 (Length: 351)
Name: NF10362_high_5
Description: NF10362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10362_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 346
Target Start/End: Original strand, 244531 - 244876
Alignment:
| Q |
1 |
gggttaatggttaatgatcctgtgttacgtactcacaaggtttgattctatatctannnnnnnnnnnnnnnnnnnnnnnnctctgttgcttactttggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||| |
|
|
| T |
244531 |
gggttaatggttaatgatcctgtgttacgtactcacaaggtttgattctatatctatttctttttatttttctttgttttctcttttgcgtactttggtt |
244630 |
T |
|
| Q |
101 |
gataagtactatttcatttcttttaactttaacagcctttgtccgtggagttgggacctgggatattgggaaatatttttgatggaattcaggtttttct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
244631 |
gataagtactatttcatttcttttaactttaacagcctttgtccgtggagttgggacctggaatattgggaaatatttttgatggaattcaggtttttct |
244730 |
T |
|
| Q |
201 |
tttaactatgaatatttggttataaatatctgatttcaattgccggcttttcaaaatttgaatattttctatcttaacagaggccattgaaaactattgc |
300 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
244731 |
tttaactatcaatatttggttataaatatctgatttcaattgccggcttttcaaaatttgaatcttttctatcttaacagaggccattgaaaactattgc |
244830 |
T |
|
| Q |
301 |
aaaaatatctgctgacgtctatattcctcgtggtgtctctgctcct |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
244831 |
aaaaatatctgctgacgtctatattcctcgtggtgtgtctgttcct |
244876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University