View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10363_high_13 (Length: 318)
Name: NF10363_high_13
Description: NF10363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10363_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 108 - 302
Target Start/End: Original strand, 31907385 - 31907579
Alignment:
| Q |
108 |
cagttcaaaatttaaaatgatgagtttgaaaggcttttatgtgtgaagttagaagttgctatataggttctgtggaggagtatctctatgaattactctt |
207 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
31907385 |
cagtttaaaatttaaaatgatgagtttgaaaggcttttatgtgtgaagttagaagttgctatataggttgtgtggaagagtatctctatggattactctt |
31907484 |
T |
|
| Q |
208 |
gtttggtattgtcattttgtagctgaaaattgaaattttatattttcaaccatatgttttctattagtttggttacattctatgatgtttagtta |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31907485 |
gtttggtattgtcattttgtagctgaaaattgaaattttatattttcaaccatatgttttctattagtttggttacattctatgatgtttagtta |
31907579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 31907266 - 31907305
Alignment:
| Q |
1 |
attatcattataattatgattatgatatgatgattatcaa |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31907266 |
attatcattataattatgattatgatatgatgattatcaa |
31907305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University