View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10363_high_3 (Length: 407)
Name: NF10363_high_3
Description: NF10363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10363_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 3e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 24 - 226
Target Start/End: Original strand, 37483604 - 37483804
Alignment:
| Q |
24 |
tcatcagcaccattttcctcctcaaattcatctacaaacagcacagaccataaactctatcagtcaaacaccaaaaacaaatacaatttaagtctctgcg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | |
|
|
| T |
37483604 |
tcatcagcaccattttcctcctcaaattcatctacaaacagcacagaccataaactctatcaatcaaacaccaaaaacaaatacaatttaagtctct--g |
37483701 |
T |
|
| Q |
124 |
caattatagagtgttttggttttagtccctgtaagnnnnnnngtttcaactcagtccctgcaaatttaaaacaagagtttttgaatttgcaggaaccgaa |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37483702 |
caattatagagtgttttggttttagtccctgtaagtttttttgtttcaactcagtccctgcaaatttaaaacaagagtttttgaatttgcaggaaccgaa |
37483801 |
T |
|
| Q |
224 |
tac |
226 |
Q |
| |
|
||| |
|
|
| T |
37483802 |
tac |
37483804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 265 - 378
Target Start/End: Original strand, 37483843 - 37483955
Alignment:
| Q |
265 |
cactataattgcggaaactagaatcatgaatagcactataattgcggaaacttaaataataccaagatcataaacaacaggtctacttccagatttgcgt |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37483843 |
cactataattgcggaaactagaatcatgaataacactataatt-cggaaacttaaataataccaagatcataaacaacaggtctacttccagatttgcgt |
37483941 |
T |
|
| Q |
365 |
aagtgaggactatt |
378 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37483942 |
aagtgaggactatt |
37483955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University