View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10363_high_5 (Length: 384)
Name: NF10363_high_5
Description: NF10363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10363_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 1 - 381
Target Start/End: Complemental strand, 26449632 - 26449252
Alignment:
| Q |
1 |
gaatttacatcatcttctgcaatctaatgtggatacctacatcaaagattcaaattggaatgttcctcaagcttctttgcctgcatatcctgctttgcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |||||||| || |
|
|
| T |
26449632 |
gaatttacatcatcttctgcaatctaatgtggatacctacatcaaagattcaaattggaatgttcctcaagcttttttggttgcatattctgctttggag |
26449533 |
T |
 |
| Q |
101 |
cagaaactattgttgactactatacctattttccctaaagaagataaactaatatagaaagcctctcatgatggaaatctagcttttaaagacgcatatc |
200 |
Q |
| |
|
|| ||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26449532 |
caaaaactattgatgactactatacctattgtccctaaagaagataaactaatatggaaagcctctcatgatggaaatttagcttttaaagacgcatatc |
26449433 |
T |
 |
| Q |
201 |
tcttcctgacttccaatcagcctcagaacatcagttgggccaaagtcatttggcacattgctatccctccttctaagtccgtgcttgtttggagactgtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26449432 |
tcttcctgacttccaatcagcctcagaacatcagttgggccaaagtcatttggcacattgctatccctccttctaagtccttgcttgtttggagactgtt |
26449333 |
T |
 |
| Q |
301 |
gcataacaagcttcctacagatgataacctctctcttagaggctttcatactacatccatttgcaatctctgtggtgctgc |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26449332 |
gcataacaagcttcctacagatgataacctctctcttagaggctgtcatactacatccatttgcaatctctgtagtgctgc |
26449252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University