View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10365_high_21 (Length: 347)
Name: NF10365_high_21
Description: NF10365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10365_high_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 12 - 288
Target Start/End: Complemental strand, 6027214 - 6026937
Alignment:
| Q |
12 |
catcatcaacaagatttttgcttcagccgttaaagaacttccacagcgcacgttagcaaccatagcccaaacgcgaaaaaagaagaagaatcactttttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6027214 |
catcatcaacaagatttttgcttcagccgttaaagaacttccacggcgcacgttagcaaccatagcccaaacgcgaaaaaagaagaagaatcactttttt |
6027115 |
T |
|
| Q |
112 |
-aatcgattcttcaaacttttttccttccaatatcaattaacatcccactcatcagaactctctggttcaggaatcttattcaaatcaactctctcagca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6027114 |
taatcgattcttcaaacttttttccttccaatatcaattaacatcccactcatcagaactctctggttcaggaatcttattcaaatcaactctctcagca |
6027015 |
T |
|
| Q |
211 |
aaatcaccagaaccatcaccttcaagcaactccggaaccggcataacacgatgatgctggttccggttatgctgaagg |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6027014 |
aaatcaccagaaccatcaccttcaagcaactccggaaccggcataacacgatgatgctggttccggttatgctgaagg |
6026937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University