View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10365_high_37 (Length: 321)
Name: NF10365_high_37
Description: NF10365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10365_high_37 |
 |  |
|
| [»] chr6 (42 HSPs) |
 |  |
|
| [»] scaffold0032 (1 HSPs) |
 |  |  |
|
| [»] scaffold1348 (1 HSPs) |
 |  |  |
|
| [»] scaffold0119 (2 HSPs) |
 |  |  |
|
| [»] scaffold0044 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |  |
|
| [»] scaffold0360 (1 HSPs) |
 |  |  |
|
| [»] scaffold0067 (1 HSPs) |
 |  |  |
|
| [»] scaffold0053 (1 HSPs) |
 |  |  |
|
| [»] scaffold0495 (1 HSPs) |
 |  |  |
|
| [»] scaffold0352 (1 HSPs) |
 |  |  |
|
| [»] scaffold0457 (1 HSPs) |
 |  |  |
|
| [»] scaffold0432 (1 HSPs) |
 |  |  |
|
| [»] scaffold0402 (1 HSPs) |
 |  |  |
|
| [»] scaffold0287 (1 HSPs) |
 |  |  |
|
| [»] scaffold0778 (1 HSPs) |
 |  |  |
|
| [»] scaffold0595 (1 HSPs) |
 |  |  |
|
| [»] scaffold0079 (1 HSPs) |
 |  |  |
|
| [»] scaffold0061 (1 HSPs) |
 |  |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 6e-71; HSPs: 42)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 165 - 321
Target Start/End: Original strand, 749710 - 749866
Alignment:
| Q |
165 |
aatcggaccataacacattaaaaacattaatcaactgaatccattgttacataaaaatcgattgaatccattnnnnnnntatcgaatacttcaatttcaa |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
749710 |
aatcggaccataacacattaaaaacattaatcaactgaatccattgttacataaaaatcgattgaatccattaaaaaaatatcgaatacttcaatttcaa |
749809 |
T |
 |
| Q |
265 |
tttaattgaaaagtttaatttgatcacgtgcctattgtataaattgggcaataatcc |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
749810 |
tttaattgaaaagtttaatttgatcacgtgcctattgtataaattgggcaataatcc |
749866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 33621577 - 33621494
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33621577 |
ctgtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
33621494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 33704299 - 33704216
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33704299 |
ctgtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
33704216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 19 - 103
Target Start/End: Complemental strand, 21000774 - 21000690
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagactg |
103 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21000774 |
tgtgaggtcccgggttcgaacccaggtcatgacgtacggccttgcaatttcggcatttgccagttgagctaggacttctagactg |
21000690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 19 - 103
Target Start/End: Complemental strand, 28323014 - 28322930
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagactg |
103 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28323014 |
tgtgaggtcccgggttcgaacccggatcatgacgtccggccttacaatttcggcatttgccagttgagctaggacttctagactg |
28322930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 18 - 102
Target Start/End: Complemental strand, 11572091 - 11572007
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||| ||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
11572091 |
ctgtgaggtcccgggttcgaacccgggtcacgacgtctggccttacaatttctgcatttgttagttgagctaggacttctagact |
11572007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 18 - 102
Target Start/End: Complemental strand, 21037373 - 21037290
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||||||| || |||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
21037373 |
ctgtgaggtcc-ggattcgaacccgagtcacaacgtccggccttgcaatttcagcatttgccagttgagctagaacttctagact |
21037290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 39 - 102
Target Start/End: Original strand, 35218694 - 35218757
Alignment:
| Q |
39 |
cccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35218694 |
cccgggtcacaacgtccggccttgcaattttggcatttgccagttgagctaggacttctagact |
35218757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 18 - 102
Target Start/End: Complemental strand, 4464210 - 4464126
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||||||||||| ||||||||||||| ||| |||||||||||||||||||||||||||| ||||||| |||| ||||||||||| |
|
|
| T |
4464210 |
ctgtgaggtcccaggttcgaacccggatcatgacgtccggccttgcaatttcggcatttgtcagttgaactagaacttctagact |
4464126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 21 - 101
Target Start/End: Original strand, 10226540 - 10226620
Alignment:
| Q |
21 |
tgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||| ||||| | |||| || ||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10226540 |
tgaggtcccgggttcgaacccgtgtcacgaagtccagctttgtaatttcggaatttgccagttgagctaggacttctagac |
10226620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 361094 - 361011
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||| ||||||||||||||| ||||| | || |||||||||||||| |||||||||||| ||||||| ||||||||||| |
|
|
| T |
361094 |
ctgtgaggttccgggttcgaacccgtgtcacgatgttcggccttgcaattttggcatttgccagatgagctaagacttctagac |
361011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 2959232 - 2959149
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||| |||||||||||| ||||| | |||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
2959232 |
ctgtgaggtctcgggttcgaacctaagtcacgatatccggccttgcaatttcggcatttgctagttgagttaggacttctagac |
2959149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 21 - 101
Target Start/End: Complemental strand, 12252103 - 12252023
Alignment:
| Q |
21 |
tgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||| ||||||| ||||| |||||| || ||||| |||||||| |||| ||||| ||||||||||||||||||||||| |
|
|
| T |
12252103 |
tgaggtctcgggttcaaaccctggtcacgacatccggtcttgcaatctcggtatttgtcagttgagctaggacttctagac |
12252023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 102
Target Start/End: Complemental strand, 33255571 - 33255488
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||||||||||| ||||||||| | ||||| ||||||| ||||| |||||| |||||||||||| ||||||||||||| |||||| |
|
|
| T |
33255571 |
ctgtgaggtcccaggttcgaactcaggtca-aacgtccagccttacaattttggcatttgccagctgagctaggacttatagact |
33255488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 42 - 101
Target Start/End: Original strand, 28592185 - 28592244
Alignment:
| Q |
42 |
gggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28592185 |
gggtcacaacgtccagccttataatttcggcatttgccagttaagctaggacttctagac |
28592244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 102 - 143
Target Start/End: Original strand, 749654 - 749695
Alignment:
| Q |
102 |
tggtccaagaaattaatctaaataattaagtacggaaatcac |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
749654 |
tggtccaagaaattaatctaaataattaagtacggaaatcac |
749695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 21 - 102
Target Start/End: Original strand, 24619127 - 24619208
Alignment:
| Q |
21 |
tgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||| |||| |||||| |||||||| |||| ||||||| |||||| | |||||| |||||||| ||||||||||||||| |
|
|
| T |
24619127 |
tgaggtcacgggatcgaactcgggtcacgacgttcggccttacaattttgacatttgtcagttgagttaggacttctagact |
24619208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 19 - 87
Target Start/End: Original strand, 584830 - 584897
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagc |
87 |
Q |
| |
|
|||||||||||| |||||| ||||||||| ||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
584830 |
tgtgaggtcccgaattcgaatccgggtcacgacgtccg-ccttgcaatttcggcatttgctagttgagc |
584897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 59 - 101
Target Start/End: Complemental strand, 14939190 - 14939148
Alignment:
| Q |
59 |
cttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14939190 |
cttgcaatttcggcatttgccagttgagttaggacttctagac |
14939148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 18 - 76
Target Start/End: Complemental strand, 16518506 - 16518448
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt |
76 |
Q |
| |
|
||||||| ||| |||||||||||| |||||||||||||| ||||||||||| ||||||| |
|
|
| T |
16518506 |
ctgtgagctcctgggttcgaacccaggtcacaacgtccgaccttgcaattttggcattt |
16518448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 18 - 103
Target Start/End: Complemental strand, 32289428 - 32289346
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagactg |
103 |
Q |
| |
|
|||||||||| || ||||||| ||| ||||||| |||||| |||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
32289428 |
ctgtgaggtctcgagttcgaattcggatcacaacatccggc-ttgcaatttcggcatttgccagtt--gctagaacttctagactg |
32289346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 1241666 - 1241598
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1241666 |
gggttcgaaccccggtcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttct |
1241598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 2314656 - 2314724
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2314656 |
gggttcgaaccccggtcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttct |
2314724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 18 - 102
Target Start/End: Original strand, 4610870 - 4610953
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||||||||||| ||||||||||||||||| | ||| |||| ||||||||| |||||| | |||| |||||| ||||||||||| |
|
|
| T |
4610870 |
ctgtgaggtcccaggttcgaacccgggtcatgatgtctggcc-tgcaatttcagcattttctagttaagctagaacttctagact |
4610953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 17534580 - 17534648
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17534580 |
gggttcgaaccccggtcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttct |
17534648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 19 - 83
Target Start/End: Complemental strand, 19145552 - 19145489
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagtt |
83 |
Q |
| |
|
||||||||||||||||| || | ||||||| |||||||||||||||||||| |||||||| |||| |
|
|
| T |
19145552 |
tgtgaggtcccgggttcaaaac-gggtcacgacgtccggccttgcaatttcagcatttgctagtt |
19145489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 97
Target Start/End: Original strand, 7197851 - 7197930
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttct |
97 |
Q |
| |
|
|||| ||||||||||||||||| ||||||| |||||| | || |||||| |||||||| || |||||||||||||||| |
|
|
| T |
7197851 |
ctgtaaggtcccgggttcgaactcgggtcaagacgtccaactttacaattttggcatttgtcaattgagctaggacttct |
7197930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 97
Target Start/End: Original strand, 29009695 - 29009774
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| |||||||| ||||||| |||||||||||| ||| ||| ||||||| | ||||| ||||||||||| |
|
|
| T |
29009695 |
ctgtgaggtcccaggttcgaattcgggtcatgacgtccggccttacaacttcagcatttgtccgttgaactaggacttct |
29009774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 8448199 - 8448267
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8448199 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
8448267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 8457003 - 8457071
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8457003 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
8457071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 8939697 - 8939629
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||| ||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8939697 |
gggttcgaaccccggtcatgacatccgacctaacaatttcggcattttgccagttgagctaggacttct |
8939629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 10181116 - 10181048
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| | |||| || |||| ||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10181116 |
gggttcgaaccccgatcacgacatccgacctaacaatttcggcattttgccagttgagctaggacttct |
10181048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 10263128 - 10263196
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggca-tttgccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10263128 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcactttgccagttgagctaggacttct |
10263196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 18861824 - 18861892
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18861824 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
18861892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 19 - 102
Target Start/End: Original strand, 7487310 - 7487393
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||||||| | ||||| ||||| || |||| ||| ||| |||| ||||||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
7487310 |
tgtgaggttctgggtttgaacctggctcacgacgcccgatcttgtaatttcgacatttgccggttgatctaggacttctagact |
7487393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 95
Target Start/End: Original strand, 8329615 - 8329681
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcat-ttgccagttgagctaggactt |
95 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
8329615 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcatattgccagttgagctaggactt |
8329681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 51 - 101
Target Start/End: Original strand, 10999486 - 10999536
Alignment:
| Q |
51 |
cgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||| ||||||| |||||||||||| || |||||||| ||||||||||| |
|
|
| T |
10999486 |
cgtccgaccttgcagtttcggcatttgtcaattgagctatgacttctagac |
10999536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 16496709 - 16496778
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt--gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16496709 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcatttttgccagttgagctaggacttct |
16496778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 63 - 100
Target Start/End: Complemental strand, 26269283 - 26269245
Alignment:
| Q |
63 |
caatttcggcattt-gccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26269283 |
caatttcggcattttgccagttgagctaggacttctaga |
26269245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 45 - 102
Target Start/End: Complemental strand, 3057458 - 3057401
Alignment:
| Q |
45 |
tcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||||||| ||||| |||||||| ||||| || ||||||||| ||||||||||| |
|
|
| T |
3057458 |
tcacaacgtccagccttacaatttcgacatttatcaattgagctagaacttctagact |
3057401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Original strand, 31205263 - 31205308
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31205263 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
31205308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 32107892 - 32107960
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| | ||| || ||| |||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32107892 |
gggttcgaaccccgatcatgacatccagcctaacaatttcggcattttgccagttgagctaggacttct |
32107960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 85; Significance: 2e-40; HSPs: 54)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 18 - 102
Target Start/End: Complemental strand, 28455957 - 28455873
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28455957 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
28455873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 18 - 102
Target Start/End: Complemental strand, 32007157 - 32007073
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32007157 |
ctgtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
32007073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 18 - 94
Target Start/End: Complemental strand, 39276433 - 39276357
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggact |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39276433 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggact |
39276357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 41761456 - 41761539
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41761456 |
ctgtgaggtcctgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgaactaggacttctagac |
41761539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 48660105 - 48660022
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48660105 |
ctgtgagatcccgggttcgaacccgggtcataacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
48660022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 18 - 102
Target Start/End: Original strand, 5055833 - 5055917
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5055833 |
ctgtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagctgagctaggacttctagact |
5055917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 19 - 98
Target Start/End: Complemental strand, 29587334 - 29587255
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttcta |
98 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29587334 |
tgtgaggtcccgggttcgaacccaggtcacgacgtccggccttgcaatttcggcatttgccagttgagctaggacttcta |
29587255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 41808285 - 41808202
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41808285 |
ctgtgaggttccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
41808202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 45813056 - 45813139
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45813056 |
ctgtgaggtcccgggttcgaacccgggtcacgatgtccgaccttgcaatttcggcatttgtcagttgagctaggacttctagac |
45813139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 18 - 102
Target Start/End: Complemental strand, 20831 - 20747
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
20831 |
ctgtgaggtcccgggttcgaatccgggtcacggcgtcctgccttgcaatttcggcatttgccagttgagttaggacttctagact |
20747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 19 - 103
Target Start/End: Original strand, 29994429 - 29994513
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagactg |
103 |
Q |
| |
|
||||||||| ||||||||||||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29994429 |
tgtgaggtctcgggttcgaacccggatcatgacgtctggccttgcaatttcggcatttgccagttgagctaggacttctagactg |
29994513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 18 - 100
Target Start/End: Complemental strand, 5943764 - 5943682
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctaga |
100 |
Q |
| |
|
||||||||||| | ||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
5943764 |
ctgtgaggtcctgagttcgaacccgggtcacgacgtccggccttgcaatttcggcatttgtcagttgagctaggaattctaga |
5943682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 18 - 100
Target Start/End: Complemental strand, 35945880 - 35945798
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctaga |
100 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35945880 |
ctgtgaggttccgggttcgaacccaggtcacaacgtccagccttacaatttcggcatttaccagttgagctaggacttctaga |
35945798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 18 - 102
Target Start/End: Complemental strand, 192498 - 192414
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||||||| |||||||||| ||| |||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
192498 |
ctgtgaggtcctgggttcgaacacggatcacaacgtccggccttgcaattttagcatttgtcagttgagctaggacttctagact |
192414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 46447422 - 46447505
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||| ||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
46447422 |
ctgtgaggtcccgggttcgaacccgggttacgacgtcgagccttgcaatttcggcatttgccagttgaactagaacttctagac |
46447505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 50106241 - 50106324
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| || ||||| |||||| | |||||||||||||| |
|
|
| T |
50106241 |
ctgtgaggtcccgggttcgaacccgggtcacaacgttcggccttgcaatctcaacatttaccagttaaattaggacttctagac |
50106324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 33 - 101
Target Start/End: Complemental strand, 45294726 - 45294658
Alignment:
| Q |
33 |
ttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||| | |||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45294726 |
ttcgaacccgggtcatgatgtccggtcttgcaatttcggcatttgctagttgagctaggacttctagac |
45294658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 33 - 102
Target Start/End: Complemental strand, 11688331 - 11688262
Alignment:
| Q |
33 |
ttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||||||| |||||||||||| ||| |||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
11688331 |
ttcgaaccagggtcacaacgttcgggcttgcaatttcgatatttgtcagttgagctaggacttctagact |
11688262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 18 - 99
Target Start/End: Complemental strand, 21939025 - 21938944
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctag |
99 |
Q |
| |
|
||||||||||| || |||||| |||| ||| || ||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21939025 |
ctgtgaggtcctggattcgaatccggatcatgacatccggccttacaatttcggcatttaccagttgagctaggacttctag |
21938944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 35224423 - 35224356
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttga |
85 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
35224423 |
ctgtgaggtcctgggttcgaacccgggtcatgacgtccggccttgcatttttcgcatttgccagttga |
35224356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 22 - 89
Target Start/End: Complemental strand, 47111536 - 47111469
Alignment:
| Q |
22 |
gaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagcta |
89 |
Q |
| |
|
||||||| |||||| ||||| |||||| ||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
47111536 |
gaggtcctgggttcaaacccaggtcacgacgtccgaccttgcaatttcggcatttgtcagttgagcta |
47111469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 33 - 101
Target Start/End: Complemental strand, 4066029 - 4065961
Alignment:
| Q |
33 |
ttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||| ||||||||| | | ||||||||||||| ||||| ||||||||||||| ||||||||| |
|
|
| T |
4066029 |
ttcgaacccggatcacaacgttcagtcttgcaatttcggtatttgtcagttgagctaggtcttctagac |
4065961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 26032884 - 26032798
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggc---cttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||| || |||||||||||||||||| ||||||| | ||| ||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
26032884 |
ctgtgaggttccaggttcgaacccgggtcacgacgtccgccgaccttacaatttcggcatttgtcagttgaattaggacttctagac |
26032798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 7275764 - 7275681
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||| || ||||||||||| ||| |||| |||||||| |||| |||||||| ||||||||||||||| || || |||||||| |
|
|
| T |
7275764 |
ctgtgaagttccgggttcgaatccgagtcataacgtccgaccttacaatttcgacatttgccagttgagttaagatttctagac |
7275681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 38 - 101
Target Start/End: Original strand, 25931214 - 25931277
Alignment:
| Q |
38 |
acccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||| |||||||| ||||| |||||||| |
|
|
| T |
25931214 |
acccgggtcacgacgtctagccttgcaatttcggcatttgtcagttgagttaggatttctagac |
25931277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 49783790 - 49783707
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||| ||||||||||||||| ||| |||| || ||||||||||||| ||||||||| ||||| |||||||| ||||| |
|
|
| T |
49783790 |
ctgtgaggttccgggttcgaacccgaatcatgacgttcgaccttgcaatttcgacatttgccaattgagttaggacttatagac |
49783707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 2088951 - 2089033
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||| | | ||||||||||| ||||| | ||| | |||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2088951 |
tgtgaggttctgagttcgaacccgagtcacgatgtctgaccttacaatttcgatatttgccagttgagctaggacttctagac |
2089033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 24119727 - 24119659
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24119727 |
gggttcgaaccccggtcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttct |
24119659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 48314238 - 48314170
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48314238 |
gggttcgaaccccggtcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttct |
48314170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 100
Target Start/End: Complemental strand, 9385822 - 9385742
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctaga |
100 |
Q |
| |
|
||||||||||||| ||| |||||||| |||| ||||||| ||||| |||| ||||||||||||||| || |||||||| |||| |
|
|
| T |
9385822 |
ctgtgaggtcccgcgtttgaacccgg-tcacgacgtccgaccttgtaatt-cggcatttgccagttaagttaggacttttaga |
9385742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 50 - 95
Target Start/End: Original strand, 16770233 - 16770278
Alignment:
| Q |
50 |
acgtccggccttgcaatttcggcatttgccagttgagctaggactt |
95 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
16770233 |
acgtccgaccttacaatttcggcatttgccagttgagctaagactt |
16770278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 10635560 - 10635492
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10635560 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
10635492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 13555781 - 13555849
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13555781 |
gggttcgaaccccggtcatgacatccggcctaataatttcggcattttgccagttgagctaggacttct |
13555849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 19338235 - 19338303
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19338235 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
19338303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 29005161 - 29005093
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29005161 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
29005093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 43676081 - 43676149
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43676081 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
43676149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 48392027 - 48391959
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48392027 |
gggttcgaaccctggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
48391959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 23 - 102
Target Start/End: Original strand, 3688286 - 3688365
Alignment:
| Q |
23 |
aggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||| ||||||||||| || |||||||||||| ||||||||||| || ||||| ||||||| |||||| || |||||| |
|
|
| T |
3688286 |
aggttccgggttcgaatccaagtcacaacgtccttccttgcaattttggaatttgtcagttgaactaggatttttagact |
3688365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 39284373 - 39284290
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||| |||||||||||| |||| ||||||| |||| ||||||| |||| | ||||||||||| ||||||||||| |
|
|
| T |
39284373 |
ctgtgaggtcttaggttcgaacccgaatcacgacgtccgaccttacaatttcaacattcgtcagttgagctatgacttctagac |
39284290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 270378 - 270447
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt--gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
270378 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcatttttgccagttgagctaggacttct |
270447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 33 - 97
Target Start/End: Complemental strand, 5790126 - 5790061
Alignment:
| Q |
33 |
ttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
||||||||| ||||| || |||||||| |||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
5790126 |
ttcgaaccccggtcatgacatccggcctaacaatttcggcattttgccagttaagctaggacttct |
5790061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 100
Target Start/End: Original strand, 15952891 - 15952960
Alignment:
| Q |
32 |
gttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||||||||| | ||| ||| |||| ||| |||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
15952891 |
gttcgaaccccgatcataacatccgacctaacaatttcggcattttgccagttgagctacgacttctaga |
15952960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Complemental strand, 28999422 - 28999377
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28999422 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
28999377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 56 - 101
Target Start/End: Original strand, 32982433 - 32982478
Alignment:
| Q |
56 |
ggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||| || ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32982433 |
ggccttacagtttcggcatttatcagttgagctaggacttctagac |
32982478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 38817245 - 38817326
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctaga |
100 |
Q |
| |
|
||||||||| ||||||||||| ||| |||| |||||||| ||| |||| ||| |||||| ||| ||| ||| | |||||||| |
|
|
| T |
38817245 |
tgtgaggtctcgggttcgaactcggatcacgacgtccggtctttcaatatcgacatttgtcagatgaactatgtcttctaga |
38817326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 100
Target Start/End: Complemental strand, 39606476 - 39606404
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt--gccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
39606476 |
gggttcgaaccccggtcatggcatccggcctaacaatatcggcatttttgccagttgagctaggacttctaga |
39606404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Original strand, 40809293 - 40809338
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40809293 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
40809338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Original strand, 40958654 - 40958699
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40958654 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
40958699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Original strand, 42631065 - 42631110
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42631065 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
42631110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 98
Target Start/End: Complemental strand, 778657 - 778578
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttcta |
98 |
Q |
| |
|
|||| |||||| |||||||||| | ||||| |||| || ||||| |||| |||||||| ||||||||||||| ||||||| |
|
|
| T |
778657 |
ctgtcaggtcctaggttcgaacctgagtcacgacgttcgaccttgtaatt-cggcattttccagttgagctagaacttcta |
778578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 95
Target Start/End: Original strand, 7204565 - 7204632
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt--gccagttgagctaggactt |
95 |
Q |
| |
|
|||||||||||| ||||| | || |||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
7204565 |
gggttcgaaccccggtcatgatgttcggcctaacaatttcggcatttttgccagttgagctaggactt |
7204632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 102
Target Start/End: Complemental strand, 13109853 - 13109769
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||||| | |||||||| ||||| || ||||||| ||||||||||| |||||| ||||| |||||| ||||||||||| |
|
|
| T |
13109853 |
ctgtgaggttctaggttcgaattcgggttacgacgtccgaccttgcaatttaatcatttgtcagttaagctagaacttctagact |
13109769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 63 - 95
Target Start/End: Complemental strand, 28689623 - 28689591
Alignment:
| Q |
63 |
caatttcggcatttgccagttgagctaggactt |
95 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
28689623 |
caatttcggcatttgccagttgagcttggactt |
28689591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 53 - 100
Target Start/End: Original strand, 32880659 - 32880707
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
32880659 |
tccggcctaacaatttcggcattttgccagttgagttaggacttctaga |
32880707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 84; Significance: 7e-40; HSPs: 61)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 32333197 - 32333114
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32333197 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
32333114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 18 - 102
Target Start/End: Original strand, 35779542 - 35779626
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35779542 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaattttggcatttgccagttgagctaggacttctagact |
35779626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 28817339 - 28817256
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28817339 |
ctgtgagatcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
28817256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 6602563 - 6602646
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6602563 |
ctgtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
6602646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 6678016 - 6678099
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6678016 |
ctgtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
6678099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 1385 - 1468
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
1385 |
ctgtgaggtcccgggttcgaaccagggtcacaacgtccggccttgcaattttggcatttgccagttgagctagaacttctagac |
1468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 7792744 - 7792661
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7792744 |
ctgtgagatcccgggttcgaacccgagtcacaacgtccagccttgcaatttcggcatttgccagttgagctaggacttctagac |
7792661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 18 - 102
Target Start/End: Original strand, 12534763 - 12534847
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||| ||| |||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12534763 |
ctgtgagatcctgggttcgaacccggatcacgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
12534847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 70568 - 70651
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
70568 |
ctgtgaggtcccgggttcaaacccgggtcatgacgtccgaccttgcaatttcggcatttgccagttgagctaggacttctagac |
70651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 4531027 - 4531110
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4531027 |
ctgtgaggtcccgggttcgaacccgggtcatgacgtccagccttgcaatttcggcatttgccaattgagctaggacttctagac |
4531110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 7813405 - 7813322
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
7813405 |
ctgtgaggtcccgggttcgaacccgagtcacaacatccggccttgcaatttcagcatttgccggttgagctaggacttctagac |
7813322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 10963285 - 10963368
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10963285 |
ctgtgaggtcccgggttcgaacctggatcacaacgttcggccttgtaatttcggcatttgccagttgagctaggacttctagac |
10963368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 19 - 102
Target Start/End: Complemental strand, 40911302 - 40911220
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40911302 |
tgtgaggtcccgg-ttcgaacccgggtcacgacgtccggccttgcaatttcggcatttgccagttgagctagcacttctagact |
40911220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 42192684 - 42192767
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||| |||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42192684 |
ctgtgagatcccgggttcgaactcgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
42192767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 1078693 - 1078776
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
1078693 |
ctgtgaggtcccgggttcgaacctgggtcatgacgtccggccttgcaatttcggcatttaccagttgagctacgacttctagac |
1078776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 3822479 - 3822396
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
3822479 |
ctgtgagatcctgggttcgaacccgggtcacaacgtccgaccttacaatttcggcatttgccagttgaactagaacttctagac |
3822396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 18 - 102
Target Start/End: Complemental strand, 9292101 - 9292017
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||||| |||||| ||||||| |||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9292101 |
ctgtgaagtcccgagttcgaattcgggtcacaacgtccggctttacaatttcgacatttgccagttgagctaggacttctagact |
9292017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 18 - 97
Target Start/End: Complemental strand, 39303392 - 39303313
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||| ||||||| ||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39303392 |
ctgtgaggtctcgggttcaaacccatgtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttct |
39303313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 45264685 - 45264767
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||| || ||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45264685 |
ctgtgaggtcccgggttcgaacccgagtcacgacgttcgacct-gcaatttcggcatttgccagttgagttaggacttctagac |
45264767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 42885257 - 42885192
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagtt |
83 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42885257 |
ctgtgagatcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagtt |
42885192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 18386791 - 18386708
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||||||||||||| |||| || |||| |||||||||||| ||||||| |||||||||||| |||||||||| |
|
|
| T |
18386791 |
ctgtgaggtcccgggttcgaacccgagtcatgacatccgaccttgcaatttcagcatttgtcagttgagctagaacttctagac |
18386708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 6099654 - 6099572
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||| ||||||||||| ||||||| ||||||||||||||||||||| ||||||| |||||| ||||||||||||||| |
|
|
| T |
6099654 |
tgtgaggtttcgggttcgaactcgggtcatgacgtccggccttgcaatttcgacatttgcaagttgaactaggacttctagac |
6099572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 18 - 77
Target Start/End: Complemental strand, 5385421 - 5385362
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttg |
77 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
5385421 |
ctgtgaggtcccgggttcgaacctgggtcacgacgtccagccttgcaatttcggcatttg |
5385362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 39435365 - 39435282
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||| ||||||||||||| | ||| ||||||| ||||||||||| | ||||||||||||||||||| |||||||||| |
|
|
| T |
39435365 |
ctgtgaggtctcgggttcgaacccagatcatgacgtccgaccttgcaattttgacatttgccagttgagctagaacttctagac |
39435282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 39 - 101
Target Start/End: Complemental strand, 29425419 - 29425357
Alignment:
| Q |
39 |
cccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
29425419 |
cccgggtcatgacgtccggccttgcaattttggcatttgccaattgagctaggacttctagac |
29425357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 21 - 103
Target Start/End: Original strand, 31969768 - 31969850
Alignment:
| Q |
21 |
tgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagactg |
103 |
Q |
| |
|
|||||||||| |||||||||||| ||| ||||| ||||||| ||||||||||||||||| || ||||| ||||||||||||| |
|
|
| T |
31969768 |
tgaggtcccgtgttcgaacccggatcatgacgtctggccttgaaatttcggcatttgccaattaagctatgacttctagactg |
31969850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 22979687 - 22979604
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||| || |||| || |||| |||| || |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22979687 |
ctgtgaggtcccggctttgaacttggatcacgacgttcgagcttgcaatttcgacatttgccagttgagctaggacttctagac |
22979604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 41849278 - 41849343
Alignment:
| Q |
20 |
gtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttga |
85 |
Q |
| |
|
||||||| |||| ||||||||| | |||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41849278 |
gtgaggttccggattcgaacccagatcacgacgtccgaccttgcaatttcggcatttgccagttga |
41849343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 45 - 101
Target Start/End: Complemental strand, 20269598 - 20269542
Alignment:
| Q |
45 |
tcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||||| ||||| ||||| |
|
|
| T |
20269598 |
tcacaacgtccggccttacaatttcggtatttgccagttgagctaagacttttagac |
20269542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 45 - 101
Target Start/End: Complemental strand, 21056227 - 21056171
Alignment:
| Q |
45 |
tcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||||| ||||| ||||| |
|
|
| T |
21056227 |
tcacaacgtccggccttacaatttcggtatttgccagttgagctaagacttttagac |
21056171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 31532170 - 31532222
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcg |
70 |
Q |
| |
|
|||||||||||| ||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
31532170 |
ctgtgaggtccccggttcaaatccgggtcacaacgtccggccttgcaatttcg |
31532222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 102
Target Start/End: Original strand, 41753037 - 41753109
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||||| ||| |||| || ||||| |||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
41753037 |
gggttcgaattcggatcacgacatccggtcttgcaatttcgacatttgtcagttgagctaggacttctagact |
41753109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 97
Target Start/End: Complemental strand, 18752424 - 18752345
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttct |
97 |
Q |
| |
|
|||| |||| |||||||||||||| | |||| ||||||| |||| ||||||||| ||||| ||||||| ||||||||||| |
|
|
| T |
18752424 |
ctgtaaggttccgggttcgaaccccgatcacgacgtccgaccttacaatttcggtatttgtcagttgaactaggacttct |
18752345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 21 - 88
Target Start/End: Complemental strand, 22203780 - 22203713
Alignment:
| Q |
21 |
tgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagct |
88 |
Q |
| |
|
||||||| ||| |||||||||||||||| ||||| | |||||||||||||| ||||| |||||||||| |
|
|
| T |
22203780 |
tgaggtctcggattcgaacccgggtcacgacgtctgaccttgcaatttcggtatttgtcagttgagct |
22203713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 100
Target Start/End: Complemental strand, 44814934 - 44814863
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||||||||||| ||||| || |||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44814934 |
gggttcgaaccccggtcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttctaga |
44814863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 95
Target Start/End: Original strand, 5700706 - 5700771
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggactt |
95 |
Q |
| |
|
|||||||||||| ||||| | | |||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
5700706 |
gggttcgaaccccggtcatagcatccggcctaacaatttcggcatttgccagttgagttaggactt |
5700771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 4430792 - 4430860
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4430792 |
gggttcgaaccccggtcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttct |
4430860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 6317371 - 6317303
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6317371 |
gggttcgaaccccggtcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttct |
6317303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 49 - 101
Target Start/End: Original strand, 42364777 - 42364829
Alignment:
| Q |
49 |
aacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||| ||| |||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
42364777 |
aacgtctggctttgcaatttcggcatttggcagttgagataggacttctagac |
42364829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 2733687 - 2733619
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2733687 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
2733619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 4977091 - 4977159
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| ||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4977091 |
gggttcgaaccccggtcatggggtccggcctaacaatttcggcattttgccagttgagctaggacttct |
4977159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 26690765 - 26690697
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26690765 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
26690697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 26738042 - 26737974
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggca-tttgccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| ||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
26738042 |
gggttcgaaccccggtcatgacatccggcctaacaatttcggcattttaccagttgagctaggacttct |
26737974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 37295197 - 37295129
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37295197 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
37295129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 38953537 - 38953605
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggca-tttgccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| ||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
38953537 |
gggttcgaaccccggtcatgacatccggcctaacaatttcggcattttgccagttgagctaagacttct |
38953605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 100
Target Start/End: Original strand, 9998700 - 9998771
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
9998700 |
gggttcgaaccccggtcatgatatccggcctaacaatttcggcattttgccagttgaactaggacttctaga |
9998771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 100
Target Start/End: Complemental strand, 10096683 - 10096612
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
10096683 |
gggttcgaaccccggtcatggcatccggcctaacaatttcgacattttgccagttgagctaggacttctaga |
10096612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 63 - 97
Target Start/End: Complemental strand, 29513913 - 29513879
Alignment:
| Q |
63 |
caatttcggcatttgccagttgagctaggacttct |
97 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29513913 |
caatttcggcatttgtcagttgagctaggacttct |
29513879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 31695315 - 31695397
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||| |||||||| ||| ||| || ||| ||||||||||| | ||| ||||||||||||||| |||||||||| |
|
|
| T |
31695315 |
tgtgaggtcccaggttcgaatccgaatcatgacatccaaccttgcaattttgacatgtgccagttgagctagaacttctagac |
31695397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 95
Target Start/End: Original strand, 37708504 - 37708570
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggactt |
95 |
Q |
| |
|
|||||||||||| ||||| | | |||| ||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
37708504 |
gggttcgaaccccggtcatagcatccgtcctaacaatttcggcattttgccagttgagctaggactt |
37708570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Original strand, 38070561 - 38070606
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38070561 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
38070606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 2907098 - 2907054
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttg |
62 |
Q |
| |
|
|||||||||||||||||| ||||||| |||| ||||||| ||||| |
|
|
| T |
2907098 |
ctgtgaggtcccgggttcaaacccggatcacgacgtccgaccttg |
2907054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 7772107 - 7772175
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttg-ccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| | ||| || |||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
7772107 |
gggttcgaaccccgatcatgacatccggcctaacaatttcggcattttaccagttgagctaggacttct |
7772175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 14188161 - 14188093
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
14188161 |
gggttcgaacccaggtcatggcatccggcctaacaatttcgacattttgccagttgagctaggacttct |
14188093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 19649555 - 19649623
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
19649555 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctatgacttct |
19649623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 25199117 - 25199049
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttg-ccagttgagctaggacttct |
97 |
Q |
| |
|
||||||||| || ||||| | | |||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
25199117 |
gggttcgaaacccggtcatagcatccggcctaacaatttcggcattttaccagttgagctaggacttct |
25199049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 25250856 - 25250788
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
25250856 |
gggttcgaaccccggtcatggcatccggcctaacaattttggcattttgccagttgagctaggacttct |
25250788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 27928229 - 27928161
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | ||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27928229 |
gggttcgaaccccggtcatggcatccggtctaacaatttcggcattttgccagttgagctaggacttct |
27928161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 53 - 96
Target Start/End: Original strand, 33067468 - 33067512
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttc |
96 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
33067468 |
tccggcctaacaatttcggcattttgccagttgagctaggacttc |
33067512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 34711612 - 34711680
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||| ||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34711612 |
gggttcgaaccccggtcatggcatccgacctaacaatttcggcattttgccagttgagctaggacttct |
34711680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 36586553 - 36586485
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||| ||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36586553 |
gggttcgaaccccggtcatggcatccgacctaacaatttcggcattttgccagttgagctaggacttct |
36586485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 84; Significance: 7e-40; HSPs: 57)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 26605707 - 26605624
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26605707 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
26605624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 10639651 - 10639734
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10639651 |
ctgtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
10639734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 11708761 - 11708678
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11708761 |
ctgtgaggtcctgggttcgaacccgggtcacaacgtccggccttacaatttcggcatttgccagttgagctaggacttctagac |
11708678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 33083599 - 33083682
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33083599 |
ctgtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
33083682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 11459798 - 11459715
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11459798 |
ctgtgaggtcccgggttcgaacccgggtcatgacgtccgaccttgcaatttcggcatttgccagttgagctaggacttctagac |
11459715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 19537390 - 19537307
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19537390 |
ctgtgaggttccgggttcgaacccggatcacaacgtccggccttgcaatttcggcatttgccagttgaactaggacttctagac |
19537307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 34460452 - 34460369
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34460452 |
ctgtgaggttctgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgtcagttgagctaggacttctagac |
34460369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 18 - 103
Target Start/End: Complemental strand, 23839942 - 23839857
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagactg |
103 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
23839942 |
ctgtgaggtcccaggttcgaacccaggtcacaacgtccggccttgcaattttggcatttgccagttgagttaggacttctagactg |
23839857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 19 - 103
Target Start/End: Complemental strand, 19048836 - 19048752
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagactg |
103 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19048836 |
tgtgaggtcccgggttcgaacccggatcatgacgtccggccttacaatttcggcatttgccagttgagctaggacttctagactg |
19048752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 22 - 101
Target Start/End: Complemental strand, 19816299 - 19816220
Alignment:
| Q |
22 |
gaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19816299 |
gaggttccgggttcaaacccgggtcacaacgtccggccttgcaatttcggtatttgccagttgagctaggacttctagac |
19816220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 39535579 - 39535662
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| ||||||| |||||||||||||| |
|
|
| T |
39535579 |
ctgtgaggtcccgggttcgaacccgggtcacgacgtccggccttgcaatttcgacatttgctagttgagttaggacttctagac |
39535662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 18 - 97
Target Start/End: Original strand, 11816596 - 11816675
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttct |
97 |
Q |
| |
|
||||||||| |||||||||||||| |||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11816596 |
ctgtgaggttccgggttcgaacccaggtcacgacgtccgaccttgcaatttcggcatttgccagttgagctaggacttct |
11816675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 18 - 89
Target Start/End: Original strand, 37197655 - 37197726
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagcta |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37197655 |
ctgtgaggtcccgggttcgaacccgggtcacgacgtccagccttgcaatttcggcatttgccagttgagcta |
37197726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 45125210 - 45125293
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||| ||| |||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45125210 |
ctgtgaggttccgagttcgaacccaagtcacaacgtccggccttacaatttcggcatttgccagttgagctaggacttctagac |
45125293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 29659263 - 29659346
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| || ||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29659263 |
ctgtgaggtcatgggttcgaacccgggtcacaatgttcggccttacaattttggcatttgccagttgagctaggacttctagac |
29659346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 19 - 103
Target Start/End: Original strand, 39831490 - 39831573
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagactg |
103 |
Q |
| |
|
||||||||||||| ||||||||||| ||| |||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
39831490 |
tgtgaggtcccgg-ttcgaacccggatcatgacgtccggccttgcaatttcggtatttgccagttgagctaggacttatagactg |
39831573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 22 - 97
Target Start/End: Original strand, 25501832 - 25501907
Alignment:
| Q |
22 |
gaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttct |
97 |
Q |
| |
|
||||| ||||||||||||| |||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25501832 |
gaggttccgggttcgaacctaggtcacgacgtccggccttgcaatttcagcatttgccagttgagctaggacttct |
25501907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 7275931 - 7276015
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggca-tttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||| |||||||||||||||| |||| |||||||| |||||||||||||| |
|
|
| T |
7275931 |
ctgtgaggtcccgggttcgaacccgggccacgacatccgaccttgcaatttcggcattttgtcagttgagttaggacttctagac |
7276015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 21 - 101
Target Start/End: Complemental strand, 34234610 - 34234530
Alignment:
| Q |
21 |
tgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||| ||||||| ||| | | ||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34234610 |
tgaggtctcgggttcaaactcagatcacaacatccgaccttgcaatttcggcatttgccagttgagctaggacttctagac |
34234530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 4851403 - 4851320
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||||| |||||||| |||| ||||||||| || ||||||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
4851403 |
ctgtgaggtcccgggtttgaacccggatcacgacgtccggctttacaatttcggcaattgacagttgagctaggacttcaagac |
4851320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 31 - 102
Target Start/End: Original strand, 40786267 - 40786338
Alignment:
| Q |
31 |
ggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||| |||||||| || |||||||||||| |
|
|
| T |
40786267 |
ggttcgaaccagggtcacgacgtccggccttgcaatttcggcatttgtcagttgagttatgacttctagact |
40786338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 40 - 101
Target Start/End: Complemental strand, 42578241 - 42578180
Alignment:
| Q |
40 |
ccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42578241 |
ccgggtcatgacgtccgaccttgcaatttcggcatttgccagttgagctaggacttctagac |
42578180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 18 - 98
Target Start/End: Complemental strand, 16654446 - 16654366
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttcta |
98 |
Q |
| |
|
||||||||| |||||||||||| ||| |||| |||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
16654446 |
ctgtgaggttccgggttcgaactcggatcacggcgtccggccttgcaatttcggcatttatcagttgagttaggacttcta |
16654366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 102
Target Start/End: Complemental strand, 7349180 - 7349097
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||||| ||| ||||||| ||| |||| ||||||||||||||||| || |||||||||||||||| | ||||||||||||| |
|
|
| T |
7349180 |
tgtgaggtctcggattcgaactcggatcacgacgtccggccttgcaatatcagcatttgccagttgagattggacttctagact |
7349097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 15782673 - 15782590
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||| ||||| ||||||||||||||||||| ||||||| |||| ||||||||||||||| || |||||||||||||| ||||| |
|
|
| T |
15782673 |
ctgtaaggtctcgggttcgaacccgggtcatgacgtccgaccttacaatttcggcatttgtcaattgagctaggacttttagac |
15782590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 27137963 - 27138045
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||| ||||||||||||||||||| |||||| | || ||||||| ||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
27137963 |
ctgtaaggtcccgggttcgaacccaggtcacgatgttcggcctt-caatttcagcatttgtcagttgagctaggacttctagac |
27138045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 22 - 98
Target Start/End: Complemental strand, 4800955 - 4800879
Alignment:
| Q |
22 |
gaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttcta |
98 |
Q |
| |
|
||||| |||||||||||| | |||||| |||||| |||||||||||||| |||||||| |||||||||| ||||||| |
|
|
| T |
4800955 |
gaggttccgggttcgaactcaggtcacgacgtccagccttgcaatttcgacatttgccggttgagctagaacttcta |
4800879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 22 - 98
Target Start/End: Original strand, 38440246 - 38440322
Alignment:
| Q |
22 |
gaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttcta |
98 |
Q |
| |
|
|||||| | |||||| | ||||||||| |||||||||||||||||||||||||||| |||||||||| | ||||||| |
|
|
| T |
38440246 |
gaggtctcaggttcggatccgggtcacgacgtccggccttgcaatttcggcatttgtcagttgagctggaacttcta |
38440322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 97
Target Start/End: Complemental strand, 43684151 - 43684073
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttct |
97 |
Q |
| |
|
|||| |||||||||||||||||| |||| |||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
43684151 |
tgtggggtcccgggttcgaacccatgtcatggtgtccggccttgcaatttcggcatttgtcagttgagataggacttct |
43684073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 102
Target Start/End: Original strand, 45201917 - 45202001
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||||| ||| |||||||| ||| |||| ||| ||| |||| |||||||| ||||||||| ||||| ||||||||||||||| |
|
|
| T |
45201917 |
ctgtgaggttccgagttcgaactcggatcacgacgaccgaccttacaatttcgacatttgccaattgagttaggacttctagact |
45202001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 19 - 97
Target Start/End: Complemental strand, 42025752 - 42025674
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| | |||||||||| | |||||| || ||||||||| ||||||| |||||| ||||||||||||||||||| |
|
|
| T |
42025752 |
tgtgaggttctgggttcgaactcaggtcacgacatccggccttaaaatttcgacatttgtcagttgagctaggacttct |
42025674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 15897285 - 15897217
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15897285 |
gggttcgaaccccggtcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttct |
15897217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 19 - 95
Target Start/End: Complemental strand, 21312287 - 21312211
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggactt |
95 |
Q |
| |
|
||||||||||| ||||||| ||| | ||||||||||||| ||| |||||| | ||||||||| ||||||||| |||| |
|
|
| T |
21312287 |
tgtgaggtcccaggttcgatcccagatcacaacgtccggtcttacaattttgacatttgccaattgagctagaactt |
21312211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 23080155 - 23080223
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23080155 |
gggttcgaaccccggtcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttct |
23080223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 50 - 98
Target Start/End: Original strand, 32844654 - 32844702
Alignment:
| Q |
50 |
acgtccggccttgcaatttcggcatttgccagttgagctaggacttcta |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
32844654 |
acgtccggccttgcaatttcggcatttgccagttgaactaaaacttcta |
32844702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 36754798 - 36754866
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36754798 |
gggttcgaaccccggtcatagcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
36754866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 95
Target Start/End: Original strand, 7975071 - 7975137
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggca-tttgccagttgagctaggactt |
95 |
Q |
| |
|
|||||||||||| ||||| | | |||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
7975071 |
gggttcgaaccccggtcatagcatccggcctaacaatttcggcattttgccagttgagctaggactt |
7975137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 2287366 - 2287434
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2287366 |
gggttcgaaccccggtcatgatatccggcctaacaatttcggcattttgccagttgagctaggacttct |
2287434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 6731613 - 6731545
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggca-tttgccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| ||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
6731613 |
gggttcgaaccccggtcatgacatccggcctaacaatttcggcattttgctagttgagctaggacttct |
6731545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 13268032 - 13268100
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||| ||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13268032 |
gggttcgaaccccggtcatgacatccgacctaacaatttcggcattttgccagttgagctaggacttct |
13268100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 23497569 - 23497637
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggca-tttgccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| |||||| || |||||||| ||||||||||| ||| |||||||| ||||||||||| |
|
|
| T |
23497569 |
gggttcgaaccccggtcacgacatccggcctaacaatttcggcattttaccagttgaactaggacttct |
23497637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 32023323 - 32023255
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32023323 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
32023255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 32 - 100
Target Start/End: Original strand, 34239879 - 34239947
Alignment:
| Q |
32 |
gttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||||||| || ||||| ||||| | |||| |||||||||||||||| ||| ||| ||||||||||||| |
|
|
| T |
34239879 |
gttcgaactcgagtcacgacgtctgaccttacaatttcggcatttgctagtagagttaggacttctaga |
34239947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 34667115 - 34667047
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||| | ||||| || |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34667115 |
gggttcgaactccggtcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttct |
34667047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 42160314 - 42160382
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| | ||| || |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42160314 |
gggttcgaaccccgatcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttct |
42160382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 76
Target Start/End: Complemental strand, 38400549 - 38400494
Alignment:
| Q |
21 |
tgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt |
76 |
Q |
| |
|
|||||||| || ||||||||| |||||| ||||||| |||||||||||||||||| |
|
|
| T |
38400549 |
tgaggtcctggattcgaaccctggtcacgacgtccgatcttgcaatttcggcattt |
38400494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 63 - 101
Target Start/End: Original strand, 8742688 - 8742726
Alignment:
| Q |
63 |
caatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
8742688 |
caatttcggcctttgtcagttgagctaggacttctagac |
8742726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 63 - 100
Target Start/End: Complemental strand, 18368832 - 18368794
Alignment:
| Q |
63 |
caatttcggcattt-gccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18368832 |
caatttcggcattttgccagttgagctaggacttctaga |
18368794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Original strand, 20251565 - 20251610
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20251565 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
20251610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Original strand, 38490480 - 38490525
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38490480 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
38490525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 12236192 - 12236124
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttg-ccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
12236192 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttaccagttgagctaggacttct |
12236124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 98
Target Start/End: Complemental strand, 33001785 - 33001706
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttcta |
98 |
Q |
| |
|
||||||||||| | |||||||||| | ||||||||| | | ||| ||||||| ||||||||||||||| |||||| |||| |
|
|
| T |
33001785 |
ctgtgaggtcctgtgttcgaacccag-tcacaacgttcagtcttacaatttcaacatttgccagttgagttaggacctcta |
33001706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 34481728 - 34481796
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | ||| |||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34481728 |
gggttcgaaccccggtcatggcatccagcctaacaatttcggcattttgccagttgagctaggacttct |
34481796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 35476547 - 35476615
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
35476547 |
gggttcgaaccccggtcatggcatccggcctaacaatttcgacattttgccagttgagctaggacttct |
35476615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 38463210 - 38463142
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| | ||| ||| |||| ||| |||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
38463210 |
gggttcgaaccccgatcataacatccgacctaacaatttcggcattttgccagttgagctaagacttct |
38463142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 39070090 - 39070022
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttg-ccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
39070090 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttaccagttgagctaggacttct |
39070022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 41164705 - 41164773
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggca-tttgccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||| || |||||||||||||||||||||||| |
|
|
| T |
41164705 |
gggttcgaaccccggtcatgatatccggcctaacaatttcgacactttgccagttgagctaggacttct |
41164773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0032 (Bit Score: 81; Significance: 4e-38; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 18 - 102
Target Start/End: Complemental strand, 56564 - 56480
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56564 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccgaccttgcaatttcggcatttgccagttgagctaggacttctagact |
56480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 80; Significance: 2e-37; HSPs: 64)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 44084023 - 44083940
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44084023 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaattttggcatttgccagttgagctaggacttctagac |
44083940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 18 - 102
Target Start/End: Complemental strand, 40058321 - 40058237
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
40058321 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaattttggcatttgccagttgagttaggacttctagact |
40058237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 2146719 - 2146636
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2146719 |
ctgtgaggtcttgggttcgaacccgggtcacaacgtccggccttgcaatttcggcattttccagttgagctaggacttctagac |
2146636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 4106821 - 4106738
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4106821 |
ctgtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgggctaggacttctagac |
4106738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 23358268 - 23358185
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23358268 |
ctgtgaggtcccgggttcgaacccgggttacgacgtccggccttgcaatttcggtatttgccagttgagctaggacttctagac |
23358185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 31770577 - 31770660
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31770577 |
ctgtgaggtcccgggttcgaacccgggtcatgacatccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
31770660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 7162834 - 7162916
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7162834 |
tgtgaggtcccgagttcgaacccgggtcacaacgtccggccttacaatttcggcatttgccagttgagctaggacttttagac |
7162916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 25546320 - 25546403
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25546320 |
ctgtgaggtcccggattcgaacccgggtcatgacgtccggccttgcaatttcggcatttaccagttgagctaggacttctagac |
25546403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 25112292 - 25112375
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25112292 |
ctgtgaggtcccgggttcgaacccaggtcatgacgtccgaccttgcaatttcggtatttgccagttgagctaggacttctagac |
25112375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 18 - 97
Target Start/End: Original strand, 43753799 - 43753878
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttct |
97 |
Q |
| |
|
||||||||| |||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43753799 |
ctgtgaggttccgggttcgaacccaggtcacgacgtccggccttgcaatttcggcatttgccagttgaactaggacttct |
43753878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 26 - 100
Target Start/End: Original strand, 47250304 - 47250378
Alignment:
| Q |
26 |
tcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47250304 |
tcccaggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctaga |
47250378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 18 - 98
Target Start/End: Complemental strand, 8439161 - 8439081
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttcta |
98 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
8439161 |
ctgtgaggtcctgggttcgaatccgggtcacaacgtccgaccttgcaattttggcatttgccagttgaactaggacttcta |
8439081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 18 - 95
Target Start/End: Original strand, 27229523 - 27229600
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggactt |
95 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||||||| |||||| |||||||| |||||||| |
|
|
| T |
27229523 |
ctgtgaggtcccgggttcgaacccaggtcacgacgtccggccttgcaatttcgacatttgtcagttgagttaggactt |
27229600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 18 - 86
Target Start/End: Complemental strand, 4107392 - 4107324
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgag |
86 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4107392 |
ctgtgaggtcccgggttcgaacccgggtcgtgacgtccggccttgcaatttcggcatttgccagttgag |
4107324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 18 - 102
Target Start/End: Complemental strand, 43203389 - 43203305
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
43203389 |
ctgtaaggtcccgggttcgaacccgggtcacggcgtcccgccttacaatttcggcatttgccagttcatctaggacttctagact |
43203305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 19 - 94
Target Start/End: Original strand, 29484801 - 29484876
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggact |
94 |
Q |
| |
|
||||||||||||||||| ||||| | ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29484801 |
tgtgaggtcccgggttcaaacccagatcatgacgtccggccttgcaatttcggcatttgccagttgagctaggact |
29484876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 18 - 98
Target Start/End: Complemental strand, 13887254 - 13887174
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttcta |
98 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| |||||||| ||||||| |||||||||||||||||||| || |||||||| |
|
|
| T |
13887254 |
ctgtgaggttccgggttcgaacctgggtcacgacgtccggtcttgcaagttcggcatttgccagttgagttaagacttcta |
13887174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 5772864 - 5772947
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||| || |||||||||||||||||| ||||| |||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
5772864 |
ctgtgaggtttcgagttcgaacccgggtcacattgtccgaccttgcaatttcggcatttgcccgttgagctaagacttctagac |
5772947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 32606375 - 32606458
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||| ||||| |||||||||||| ||||||| |||||||||||||||||||||| ||||| |||||||| ||| |||||||||| |
|
|
| T |
32606375 |
ctgtaaggtctcgggttcgaacctgggtcacgacgtccggccttgcaatttcggtatttgtcagttgagttagaacttctagac |
32606458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 38033812 - 38033729
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||| || |||||||| |||||| ||||| |||| |||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
38033812 |
ctgtgaggtcccggatttgaacccggatcacaatgtccgaccttacaatttcggcatttgccagttgagttagaacttctagac |
38033729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 47557864 - 47557781
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||| || ||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
47557864 |
ctgtgaggttccgggttcgaacccgggtcatgacgtgcgaccttgtaatttcggcatttaccagttgagttaggacttctagac |
47557781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 30 - 102
Target Start/End: Complemental strand, 29255788 - 29255716
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||||||||||||| |||| |||||| ||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
29255788 |
gggttcgaacccggatcacgacgtccaaccttgcaattttggcatttgccagttgagctagaacttctagact |
29255716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 90
Target Start/End: Complemental strand, 5587362 - 5587291
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctag |
90 |
Q |
| |
|
|||||||||| |||||||||||||| |||| | |||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
5587362 |
tgtgaggtcctgggttcgaacccggatcacgatgtccggacttgcaatttcggcatttgtcagttgagctag |
5587291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 90
Target Start/End: Complemental strand, 5592323 - 5592252
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctag |
90 |
Q |
| |
|
|||||||||| |||||||||||||| |||| | |||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
5592323 |
tgtgaggtcctgggttcgaacccggatcacgatgtccggacttgcaatttcggcatttgtcagttgagctag |
5592252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 39 - 101
Target Start/End: Complemental strand, 34763516 - 34763454
Alignment:
| Q |
39 |
cccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
34763516 |
cccgggtcacgacgtccgcccttgcaatttcgacattttccagttgagctaggacttctagac |
34763454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 18 - 100
Target Start/End: Complemental strand, 48146836 - 48146754
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| || || | |||||||||||| |||||| |||||||||||| || |||||| |
|
|
| T |
48146836 |
ctgtgaggtcccgggttcgaacccgggtcacgacatctgaccttgcaatttctgcatttttcagttgagctagaacctctaga |
48146754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 102
Target Start/End: Complemental strand, 11355906 - 11355822
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||| ||||||||||||| || | ||| |||||||| |||||||||||||||||||| |||||| |||| ||||||||||| |
|
|
| T |
11355906 |
ctgtgagatcccgggttcgaatccagatcataacgtccgaccttgcaatttcggcatttgttagttgaactagaacttctagact |
11355822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 102
Target Start/End: Original strand, 15634924 - 15635008
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||||| || |||| |||||| ||||||||| ||||||| | || |||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
15634924 |
ctgtgaagttccggtttcgaatccgggtcacgacgtccgactttacaatttcggcatttgctagttgagctatgacttctagact |
15635008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 22 - 101
Target Start/End: Original strand, 4001891 - 4001970
Alignment:
| Q |
22 |
gaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||| ||||||||||||||||| || |||||||||||||||||| ||||| ||||||| ||| ||| ||||||| |
|
|
| T |
4001891 |
gaggtcccgagttcgaacccgggtcacgacatccggccttgcaatttcgacattttccagttgtactatgacatctagac |
4001970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 19 - 86
Target Start/End: Complemental strand, 28603093 - 28603026
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgag |
86 |
Q |
| |
|
||||| ||| ||||||||||| | |||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28603093 |
tgtgaagtctcgggttcgaactcaggtcacgacgtccggccttgcgatttcggcatttgccagttgag |
28603026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 100
Target Start/End: Original strand, 42081662 - 42081743
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctaga |
100 |
Q |
| |
|
||||||||||| || ||||||||||| ||||||||| || |||||||||| | |||||||||| |||||||||||||||||| |
|
|
| T |
42081662 |
ctgtgaggtccagg-ttcgaacccggatcacaacgttcgatcttgcaattttgacatttgccagctgagctaggacttctaga |
42081743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 72
Target Start/End: Original strand, 47570763 - 47570817
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggc |
72 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47570763 |
ctgtgagatcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggc |
47570817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 41183886 - 41183833
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagtt |
83 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41183886 |
gggttcgaacccaggtcaagacgtccggccttgcaatttcggcatttgccagtt |
41183833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 36 - 101
Target Start/End: Original strand, 43171002 - 43171067
Alignment:
| Q |
36 |
gaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||| |||| || |||||||||||||||||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
43171002 |
gaacctgggttacgacgtccggccttgcaatttcggcatttgtcagttgagttaggacttatagac |
43171067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 39514028 - 39514080
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcg |
70 |
Q |
| |
|
|||| ||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
39514028 |
ctgtaaggtcccgggttcgaactcgggtcacgacgtccggccttgcaatttcg |
39514080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 102
Target Start/End: Complemental strand, 25872833 - 25872762
Alignment:
| Q |
31 |
ggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||||||||| || |||| ||||||| ||||| ||| ||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
25872833 |
ggttcgaacctggatcacgacgtccgaccttgtaatatcggcatttgccaattgagttaggacttctagact |
25872762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 101
Target Start/End: Original strand, 47961004 - 47961083
Alignment:
| Q |
22 |
gaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| | ||||| ||||| ||||||||| ||||||| || ||||||||||| |
|
|
| T |
47961004 |
gaggtcccgggttcgaacccggttcatgacgtctgaccttgtaattttggcatttgcaagttgagttaagacttctagac |
47961083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 101
Target Start/End: Original strand, 48444209 - 48444280
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||| | |||| |||||| | ||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48444209 |
gggttcgaacccagatcacgacgtccagtcttacaatttcggcatttttcagttgagctaggacttctagac |
48444280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 43 - 101
Target Start/End: Original strand, 27915651 - 27915709
Alignment:
| Q |
43 |
ggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||| ||||||| |||||||||||| |||||| ||||||||| |||||||||||||| |
|
|
| T |
27915651 |
ggtcacgacgtccgaccttgcaatttcagcatttaccagttgagttaggacttctagac |
27915709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 23 - 101
Target Start/End: Complemental strand, 40643052 - 40642974
Alignment:
| Q |
23 |
aggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||| |||||| |||||||| |||||| ||| |||||| |||||||| |||||| ||||||||||| || |||||||| |
|
|
| T |
40643052 |
aggtctcgggtttgaacccggatcacaatgtctggccttacaatttcgacatttgtcagttgagctaagatttctagac |
40642974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 35157141 - 35157209
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35157141 |
gggttcgaaccccggtcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttct |
35157209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 45237001 - 45236933
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45237001 |
gggttcgaaccccggtcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttct |
45236933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 10220517 - 10220600
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||| ||| ||||||||| | ||| |||||| ||||| |||||| ||| ||||||||||||| |||||||||||||| |
|
|
| T |
10220517 |
ctgtgaggtttcggattcgaacccagatcatgacgtcctgccttacaattttggcttttgccagttgagttaggacttctagac |
10220600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 69
Target Start/End: Original strand, 38781253 - 38781304
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttc |
69 |
Q |
| |
|
||||||||||||||||||||| ||||||||| || | ||||||||||||||| |
|
|
| T |
38781253 |
ctgtgaggtcccgggttcgaatccgggtcacgacattcggccttgcaatttc |
38781304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 1323754 - 1323686
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
1323754 |
gggttcgaaccctggtcatgacatccggcctaacaaattcggcattttgccagttgagctaggacttct |
1323686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 2354854 - 2354922
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||| | ||||| || |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2354854 |
gggttcgaactccggtcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttct |
2354922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 3497574 - 3497642
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3497574 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
3497642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 7312510 - 7312578
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| |||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
7312510 |
gggttcgaaccccggtcatgacatccggcctaacaattttggcattttgccagttgagctaggacttct |
7312578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 9380062 - 9379994
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| |||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
9380062 |
gggttcgaaccccggtcatgacatccggcctaacaatttcgacattttgccagttgagctaggacttct |
9379994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 35849366 - 35849298
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggca-tttgccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35849366 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcactttgccagttgagctaggacttct |
35849298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 40809116 - 40809048
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
40809116 |
gggttcgaaccctggtcatgacatccggcctaacaaattcggcattttgccagttgagctaggacttct |
40809048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 48612588 - 48612520
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48612588 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
48612520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 100
Target Start/End: Original strand, 37410759 - 37410830
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||||||||||| |||| || |||||||| |||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
37410759 |
gggttcgaaccccagtcatgacatccggcctaacaatttcggcattttgccagttgagctaagacttctaga |
37410830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 43 - 101
Target Start/End: Original strand, 28111001 - 28111059
Alignment:
| Q |
43 |
ggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||| ||||||| |||||||||||| |||||| |||||||| || ||||||||||| |
|
|
| T |
28111001 |
ggtcacgacgtccgatcttgcaatttcgacatttgtcagttgagttaagacttctagac |
28111059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 63 - 100
Target Start/End: Original strand, 36280015 - 36280053
Alignment:
| Q |
63 |
caatttcggcattt-gccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36280015 |
caatttcggcattttgccagttgagctaggacttctaga |
36280053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Original strand, 4887593 - 4887638
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4887593 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
4887638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Original strand, 27396394 - 27396439
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27396394 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
27396439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 101
Target Start/End: Complemental strand, 33512845 - 33512796
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
33512845 |
tccggcctaacaatttcggcattttgccagttgagctaggacttatagac |
33512796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Original strand, 48729764 - 48729809
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48729764 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
48729809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 1573898 - 1573966
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttg-ccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
1573898 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttaccagttgagctaggacttct |
1573966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 4106625 - 4106557
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttg-ccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
4106625 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttaccagttgagctaggacttct |
4106557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 18944995 - 18944927
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
18944995 |
gggttcgaaccccggtcatgatatccggcctaacaatttcggcattttgccagttgaactaggacttct |
18944927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 19306783 - 19306715
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19306783 |
gggttcgaaccccggtcatggcatccggcctaataatttcggcattttgccagttgagctaggacttct |
19306715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 29151654 - 29151586
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| | ||| | | |||||||| ||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
29151654 |
gggttcgaaccccgatcatagcatccggcctaacaatttcagcattttgccagttgagctaggacttct |
29151586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 80; Significance: 2e-37; HSPs: 55)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 13204040 - 13203957
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13204040 |
ctgtgaggtcccgggttcgaacccgggtcacgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
13203957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 21018306 - 21018223
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21018306 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggcctcgcaattttggcatttgccagttgagctaggacttctagac |
21018223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 18 - 100
Target Start/End: Original strand, 4824984 - 4825066
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctaga |
100 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4824984 |
ctgtgaggtcccgggtttgaacctgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctaga |
4825066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 1191586 - 1191668
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1191586 |
tgtgaggtcccgggttcgaacccggatcacgacgtccggccttgcaatttcgtcatttgccagttgagctaggacttctagac |
1191668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 35317742 - 35317825
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35317742 |
ctgtgaggtcccgggttcgaccccaggtcataacgtccgaccttgcaatttcggcatttgccagttgagctaggacttctagac |
35317825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 21 - 102
Target Start/End: Complemental strand, 12257436 - 12257355
Alignment:
| Q |
21 |
tgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12257436 |
tgaggtcctgggttcgaacccaggtcacaacgtctggccttacaatttcggcatttgccagttgagctaggacttctagact |
12257355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 27721514 - 27721431
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||| | ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27721514 |
ctgtgaggtcccgggttcaaacccgggtcacgacgtccgactttgcaatttcggcattttccagttgagctaggacttctagac |
27721431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 18 - 97
Target Start/End: Complemental strand, 8734079 - 8734000
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttct |
97 |
Q |
| |
|
||||||||| ||||||||||||| |||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8734079 |
ctgtgaggttccgggttcgaacctaggtcacgacgtccggccttgcaatttcagcatttgccagttgagctaggacttct |
8734000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 9577006 - 9577089
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||| | |||||||||||| ||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9577006 |
ctgtgaggttctgggttcgaacccaggtcatgacgtctggccttgcaatttcagcatttgccagttgagctaggacttctagac |
9577089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 39 - 102
Target Start/End: Original strand, 32143468 - 32143531
Alignment:
| Q |
39 |
cccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
32143468 |
cccgggtcacaacgtccggccttgcaattttggcatttgccagttgagctatgacttctagact |
32143531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 28 - 101
Target Start/End: Original strand, 3386955 - 3387028
Alignment:
| Q |
28 |
ccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||| | || |||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
3386955 |
ccgggttcgaacccggataacgacgtccggccttgcaatttcggcatttgccagttgaactaggacttttagac |
3387028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 22 - 98
Target Start/End: Complemental strand, 6021071 - 6020995
Alignment:
| Q |
22 |
gaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttcta |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||| | ||||||||| ||||| ||||||||||| |
|
|
| T |
6021071 |
gaggtcccgggttcgaatccgggtcacaacgtcaggccttgcaattttgacatttgccaattgagttaggacttcta |
6020995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 2971067 - 2970984
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||| | |||| |||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
2971067 |
ctgtgaggtctcaggttcgaacccgggtcacaacgtctgaccttacaatttcgacatttatcagttgagctaggacttctagac |
2970984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 35 - 101
Target Start/End: Complemental strand, 30127960 - 30127894
Alignment:
| Q |
35 |
cgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
30127960 |
cgaacccgggtcacgatgtccggccttgcaatttcggcatttacaagttgagctaggacttctagac |
30127894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 103
Target Start/End: Complemental strand, 29265958 - 29265873
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagactg |
103 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| | || ||||| ||||||| ||||| | ||||||| |||||||||||||||| |
|
|
| T |
29265958 |
ctgtgaggtcccgggttcgaatccgggtcacaacattcgaccttgtaatttcgacattttctagttgagttaggacttctagactg |
29265873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 28 - 101
Target Start/End: Complemental strand, 40177697 - 40177624
Alignment:
| Q |
28 |
ccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||| ||| || |||||||||||||||||||||||||||| |||||| ||||| ||||||||||||||||| |
|
|
| T |
40177697 |
ccgggttggaatccaggtcacaacgtccggccttgcaatttcgacatttgtcagttaagctaggacttctagac |
40177624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 21 - 101
Target Start/End: Complemental strand, 11124732 - 11124652
Alignment:
| Q |
21 |
tgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||| | ||||||||| | |||||| ||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
11124732 |
tgaggttctgggttcgaatcaaggtcacgacgtccggccttgcaattttgacatttgccagttgagctaggacttctagac |
11124652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 104
Target Start/End: Original strand, 28591395 - 28591481
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagactgg |
104 |
Q |
| |
|
||||||||| | |||| ||||||| ||||| |||||||||||||||||||| | ||||||||||| || ||||||||||| ||||| |
|
|
| T |
28591395 |
ctgtgaggtttcaggtttgaacccgagtcactacgtccggccttgcaatttcagtatttgccagtttagttaggacttctaaactgg |
28591481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 21 - 101
Target Start/End: Complemental strand, 21112129 - 21112049
Alignment:
| Q |
21 |
tgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||| |||||||||| |||||| |||| | ||||||||||||| |||||| ||| ||||||||||||||||||| |
|
|
| T |
21112129 |
tgaggtcccaggttcgaacctaggtcacgacgtatgtccttgcaatttcgacatttgtcagctgagctaggacttctagac |
21112049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 74
Target Start/End: Original strand, 31909430 - 31909486
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcat |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||||| |||| |
|
|
| T |
31909430 |
ctgtgaggtcccgggttcgaacccgggtcatgacgtctggccttgcaatttcagcat |
31909486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 35546016 - 35545933
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||| |||||||| ||| |||| |||| ||| |||||||||||||||||| |||||||| ||| |||||||||| |
|
|
| T |
35546016 |
ctgtgaggtcccaggttcgaattcggatcacgacgttcggttttgcaatttcggcatttgtcagttgagttagaacttctagac |
35545933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 18 - 92
Target Start/End: Original strand, 3049099 - 3049173
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctagga |
92 |
Q |
| |
|
||||||||||||||||| ||| |||||||| |||||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
3049099 |
ctgtgaggtcccgggtttgaaatcgggtcacggcgtccggccttgcaattttggcatttgtgagttgaactagga |
3049173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 39 - 101
Target Start/End: Complemental strand, 17465153 - 17465091
Alignment:
| Q |
39 |
cccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||| || ||||||||||||| ||||| |
|
|
| T |
17465153 |
cccgggtcatgacgtccagccttgcaatttcggcatttgctagctgagctaggacttttagac |
17465091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 18 - 100
Target Start/End: Original strand, 17984787 - 17984869
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctaga |
100 |
Q |
| |
|
||||||||| ||||||||||||||| |||| |||||| |||||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
17984787 |
ctgtgaggttccgggttcgaacccgagtcaggacgtccaatcttgcaatttcgacctttttcagttgagctaggacttctaga |
17984869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 4165030 - 4164962
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4165030 |
gggttcgaaccccggtcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttct |
4164962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 2786354 - 2786271
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||| |||| ||| ||| |||| |||||| |||| |||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
2786354 |
ctgtgaggtcccaggtttgaattcggatcacggcgtccgaccttacaatttcggcatttgccaattgaattaggacttctagac |
2786271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 46 - 101
Target Start/End: Complemental strand, 38955283 - 38955228
Alignment:
| Q |
46 |
cacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||| ||| |||||||||||||||||||| | ||||||||||| |||||||||| |
|
|
| T |
38955283 |
cacaacatcccgccttgcaatttcggcatttactagttgagctagaacttctagac |
38955228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 63 - 97
Target Start/End: Original strand, 4444938 - 4444972
Alignment:
| Q |
63 |
caatttcggcatttgccagttgagctaggacttct |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4444938 |
caatttcggcatttgccagttgagctaggacttct |
4444972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 1244238 - 1244306
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1244238 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
1244306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 6672312 - 6672244
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6672312 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
6672244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 9902558 - 9902626
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| | ||| | | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9902558 |
gggttcgaaccccgatcatagcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
9902626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 17869181 - 17869249
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17869181 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
17869249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 18473985 - 18473917
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18473985 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
18473917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 23311230 - 23311298
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23311230 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
23311298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 53 - 100
Target Start/End: Original strand, 25328384 - 25328432
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25328384 |
tccggcctaacaatttcggcattttgccagttgagctaggacttctaga |
25328432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 29119677 - 29119609
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29119677 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
29119609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 36569350 - 36569282
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36569350 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
36569282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 100
Target Start/End: Original strand, 6053108 - 6053179
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||||||||||| ||||| || |||| ||| |||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
6053108 |
gggttcgaaccccggtcatgacatccgacctaacaatttcggcattttgtcagttgagctaggacttctaga |
6053179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 60 - 94
Target Start/End: Original strand, 15206821 - 15206855
Alignment:
| Q |
60 |
ttgcaatttcggcatttgccagttgagctaggact |
94 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15206821 |
ttgcaatttcggcatttaccagttgagctaggact |
15206855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 21728732 - 21728663
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt--gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21728732 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcatttttgccagttgagctaggacttct |
21728663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 23074701 - 23074770
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt--gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23074701 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcatttttgccagttgagctaggacttct |
23074770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Complemental strand, 2103074 - 2103029
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2103074 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
2103029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Original strand, 12878198 - 12878243
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12878198 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
12878243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Original strand, 28143312 - 28143357
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28143312 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
28143357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Complemental strand, 36727037 - 36726992
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36727037 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
36726992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 100
Target Start/End: Original strand, 36790372 - 36790444
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt--gccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||||||||||| ||||| | | |||||||| ||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
36790372 |
gggttcgaaccccggtcatagcatccggcctaataatttcggcatttttgccagttaagctaggacttctaga |
36790444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Complemental strand, 41562506 - 41562461
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41562506 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
41562461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 45 - 100
Target Start/End: Complemental strand, 2755981 - 2755925
Alignment:
| Q |
45 |
tcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||| |||| |||||||||||||||||||||| | ||||||||||| ||||||||| |
|
|
| T |
2755981 |
tcaccacgttcggccttgcaatttcggcatttatcaagttgagctagaacttctaga |
2755925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 50 - 95
Target Start/End: Original strand, 8595564 - 8595611
Alignment:
| Q |
50 |
acgtccggccttgcaatttcggcattt--gccagttgagctaggactt |
95 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
8595564 |
acgtccggcctaacaatttcggcatttttgccagttgagctaggactt |
8595611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 9054028 - 9054096
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| ||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
9054028 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggtattttgccagttgagctaggacttct |
9054096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 95
Target Start/End: Original strand, 22792167 - 22792234
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt--gccagttgagctaggactt |
95 |
Q |
| |
|
|||||||||||| |||| ||||||| ||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
22792167 |
gggttcgaacccctgtcaagacgtccgacctaacaatttcggcatttttgccagttgagctaggactt |
22792234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 24443924 - 24443992
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
||||| |||||| ||||| ||| |||| ||| ||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
24443924 |
gggtttgaaccccggtcataacatccgacctaacaatttcggtattttgccagttgagctaggacttct |
24443992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 36136919 - 36136987
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | | | |||||| |||||||||||||| || |||||||||||||||||| |
|
|
| T |
36136919 |
gggttcgaaccccggtcatagcattcggcctaacaatttcggcattttgctagttgagctaggacttct |
36136987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 53 - 100
Target Start/End: Complemental strand, 37940966 - 37940918
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||||||| |||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
37940966 |
tccggcctaacaatttcgacattttgccagttgagctaggacttctaga |
37940918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 42448282 - 42448214
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
42448282 |
gggttcgaaccccggtcatggcatccggcctaacaatttcgacattttgccagttgagctaggacttct |
42448214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 78; Significance: 3e-36; HSPs: 62)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 18 - 103
Target Start/End: Original strand, 43247695 - 43247780
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagactg |
103 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43247695 |
ctgtgaggtcccgggttcgaacccaggtcacaacgtccggccttgcaattttggcatttgccagttgagctaggacttctagactg |
43247780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 7824499 - 7824582
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7824499 |
ctgtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
7824582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 29689527 - 29689610
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29689527 |
ctgtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
29689610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 54151726 - 54151809
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54151726 |
ctgtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
54151809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 18 - 103
Target Start/End: Complemental strand, 4601508 - 4601423
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagactg |
103 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4601508 |
ctgtgaggttccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagactg |
4601423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 54158349 - 54158266
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54158349 |
ctgtgaggtcccgggttcgaacccggatcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
54158266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 1778933 - 1778851
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1778933 |
tgtgaggttccgggttcgaacccgggtcacaatgtccggccttgcaatttcggcatttgtcagttgagctaggacttctagac |
1778851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 18 - 102
Target Start/End: Original strand, 35461524 - 35461608
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35461524 |
ctgtgaggttccgggttcgaacccggatcacaacgtccgaccttgcaatttcggcatttgccagttgagctagaacttctagact |
35461608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 28844587 - 28844504
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
28844587 |
ctgtgaggttccaggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgtcagttgagctagaacttctagac |
28844504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 51665970 - 51666053
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51665970 |
ctgtaaggtcccgggttcgaacccaggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
51666053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 55018079 - 55018162
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| | ||||||||||||||| |||||||||||||| |
|
|
| T |
55018079 |
ctgtgaggtcccgggttcgaacccgggtcacgacgtccggccttgcaattttgacatttgccagttgagttaggacttctagac |
55018162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 19 - 103
Target Start/End: Original strand, 42392851 - 42392935
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagactg |
103 |
Q |
| |
|
||||||||||||||||||| ||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42392851 |
tgtgaggtcccgggttcgagcccggatcatgacgtccgaccttgcaatttcggcatttgccagttgagctaggacttctagactg |
42392935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 33334691 - 33334608
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||| ||||||| | |||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33334691 |
ctgtgaggtcccggattcgaactcaggtcacaacgtccggctttgcaatttcggcatttgcaagttgagctaggacttctagac |
33334608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 18 - 89
Target Start/End: Original strand, 36229039 - 36229110
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagcta |
89 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36229039 |
ctgtgaggtcccgggttcgaacccggatcatgacgtccggccttgcaatttcggcatttgccagttgagcta |
36229110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 41377665 - 41377584
Alignment:
| Q |
20 |
gtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||||||||| || ||| |||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41377665 |
gtgaggtcccgggttcgaacctggatcatgacgtccggccttacaattttggcatttgccagttgagctaggacttctagac |
41377584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 18 - 89
Target Start/End: Original strand, 3113040 - 3113111
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagcta |
89 |
Q |
| |
|
||||||| |||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3113040 |
ctgtgagatcccgggttcgaactcgggttacgacgtccggccttgcaatttcggcatttgccagttgagcta |
3113111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 9349721 - 9349788
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttga |
85 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9349721 |
ctgtgaggtcccgggttcgaacccggatcacgacgtccgaccttgcaatttcggcatttgccagttga |
9349788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 18 - 103
Target Start/End: Complemental strand, 52500921 - 52500836
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagactg |
103 |
Q |
| |
|
||||||||| | ||||||||||||| ||| |||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52500921 |
ctgtgaggtttcaggttcgaacccggatcatgacgtccggccttacaatttcgacatttgccagttgagctaggacttctagactg |
52500836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 51112521 - 51112588
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
51112521 |
gggttcgaaccccggtcatgacgtccggcctagcaatttcggcatttgccagttgagctaggacttct |
51112588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 29750703 - 29750621
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||| | ||||||| ||||||||| |||||| |||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
29750703 |
tgtgaggtctctagttcgaatccgggtcacgacgtccagccttgcaatttcggcatttgccagttgagttagtacttctagac |
29750621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 31255488 - 31255406
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||| || || ||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
31255488 |
tgtgaggacccgggttcgaacccgggtcacgacgtccagctttataatttcgacatttgtcagttgagttaggacttctagac |
31255406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 100
Target Start/End: Original strand, 2590848 - 2590928
Alignment:
| Q |
20 |
gtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctaga |
100 |
Q |
| |
|
||||||||| |||||||||||| | |||| | || |||||||||||||||| ||||| ||||||||| |||||||| |||| |
|
|
| T |
2590848 |
gtgaggtccagggttcgaacccagatcacgatgttcggccttgcaatttcgacattttccagttgagttaggacttataga |
2590928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 42 - 98
Target Start/End: Original strand, 45686096 - 45686152
Alignment:
| Q |
42 |
gggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttcta |
98 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||| |||||||||| |||||||| |
|
|
| T |
45686096 |
gggtcacgacgtccggcctttcaatttcggcatttgctagttgagctaagacttcta |
45686152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 7958652 - 7958569
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||| |||| | ||| || || |||||| | |||||| |||||||| |||||||||||||| |
|
|
| T |
7958652 |
ctgtgaggtcccgggttcgaacccggatcacggcatcctgctttacaattttgacatttgtcagttgaggtaggacttctagac |
7958569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 100
Target Start/End: Complemental strand, 11312661 - 11312590
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||||||||||| ||||| | | |||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11312661 |
gggttcgaaccccggtcatagcatccggcctaacaatttcggcattttgccagttgagctaggacttctaga |
11312590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 43775306 - 43775223
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||| | |||| ||||||| | ||||||||||||| |||| |||||||||||||||||||||||| ||| |||| ||||| |
|
|
| T |
43775306 |
ctgtgagattccggattcgaacgcaagtcacaacgtccgaccttacaatttcggcatttgccagttgagttagaacttttagac |
43775223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 95
Target Start/End: Original strand, 475325 - 475402
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggactt |
95 |
Q |
| |
|
||||||||| ||| |||||||||||| ||| ||||||| |||||||||||| |||||| |||||||| ||| ||||| |
|
|
| T |
475325 |
ctgtgaggttccgagttcgaacccggatcatgacgtccgaccttgcaatttcagcatttcccagttgatctaagactt |
475402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 3917837 - 3917769
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3917837 |
gggttcgaaccccggtcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttct |
3917769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 18 - 102
Target Start/End: Original strand, 32001469 - 32001553
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||| || || ||||||||| || ||| | || ||||||| |||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
32001469 |
ctgtgagatctcgagttcgaacctggttcaagatgttcggccttacaatttcggcatttaccagttgaggtaggacttctagact |
32001553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 28458745 - 28458663
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||| | |||||| |||| || |||| || || ||||||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
28458745 |
ctgtgaggttctgggttcaaacc-ggatcacgacatctggccttgcaatttcgacatttgtcagttgagttaggacttctagac |
28458663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 63 - 97
Target Start/End: Original strand, 14868945 - 14868979
Alignment:
| Q |
63 |
caatttcggcatttgccagttgagctaggacttct |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
14868945 |
caatttcggcatttgccagttgagctaggacttct |
14868979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 32 - 102
Target Start/End: Complemental strand, 50729593 - 50729523
Alignment:
| Q |
32 |
gttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||| || | |||| ||||| | |||| ||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
50729593 |
gttcgaatccagatcacgacgtctgaccttacaatttcggcatttgtcagttgagctagaacttctagact |
50729523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 32 - 102
Target Start/End: Original strand, 50783256 - 50783326
Alignment:
| Q |
32 |
gttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||| || | |||| ||||| | |||| ||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
50783256 |
gttcgaatccagatcacgacgtctgaccttacaatttcggcatttgtcagttgagctagaacttctagact |
50783326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 4232234 - 4232302
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4232234 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
4232302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 4833166 - 4833234
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4833166 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
4833234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 8381150 - 8381082
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8381150 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
8381082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 13525240 - 13525172
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13525240 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
13525172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 24250796 - 24250728
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggca-tttgccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | | |||||||| ||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
24250796 |
gggttcgaaccccggtcatagcatccggcctaacaatttcggcattttgccaattgagctaggacttct |
24250728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 22 - 97
Target Start/End: Complemental strand, 27396933 - 27396857
Alignment:
| Q |
22 |
gaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggca-tttgccagttgagctaggacttct |
97 |
Q |
| |
|
||||| |||||||||||||| ||||| | |||||||| ||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
27396933 |
gaggtaccgggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgtcagttgagctaggacttct |
27396857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 38127899 - 38127967
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | | |||||||| |||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
38127899 |
gggttcgaaccccggtcatagcatccggcctaacaatttcgacattttgccagttgagctaggacttct |
38127967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 40756772 - 40756856
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaa-cgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||| |||||||||| |||| ||| | |||| | ||||||||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
40756772 |
ctgtgaggtctcgggttcgaatccggatcatgatcgtctgaccttgcaattttggcatttttcagttgagttaggacttctagac |
40756856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 33 - 97
Target Start/End: Complemental strand, 47770393 - 47770329
Alignment:
| Q |
33 |
ttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttct |
97 |
Q |
| |
|
|||||| || |||||| ||||||| |||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
47770393 |
ttcgaatccaggtcacgacgtccgagcttgcaatttcgacatttatcagttgagctaggacttct |
47770329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 32 - 100
Target Start/End: Complemental strand, 51054770 - 51054702
Alignment:
| Q |
32 |
gttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctaga |
100 |
Q |
| |
|
||||||||||| ||| ||||| || ||||| ||||||| |||||| |||||||| ||||||||||||| |
|
|
| T |
51054770 |
gttcgaacccgaatcataacgttcgaccttgtaatttcgacatttgtcagttgagttaggacttctaga |
51054702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 18 - 89
Target Start/End: Original strand, 448920 - 448991
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagcta |
89 |
Q |
| |
|
||||||||||| |||||||| ||| |||| |||||||||||| |||||| | |||||| ||||||||||| |
|
|
| T |
448920 |
ctgtgaggtcctaggttcgaattcggatcacgacgtccggccttacaattttgacatttgtcagttgagcta |
448991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 19 - 70
Target Start/End: Original strand, 38257349 - 38257400
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcg |
70 |
Q |
| |
|
|||||||| | |||||||||||| |||||| ||||||| ||||||||||||| |
|
|
| T |
38257349 |
tgtgaggttctgggttcgaacccaggtcacgacgtccgaccttgcaatttcg |
38257400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 42296782 - 42296715
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| |||||| ||||||| ||||||||||||||||||| |
|
|
| T |
42296782 |
gggttcgaaccccggtcatgacatccggcctaacaattttggcattttgcagttgagctaggacttct |
42296715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 22 - 101
Target Start/End: Original strand, 47635054 - 47635133
Alignment:
| Q |
22 |
gaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||| || ||||||||| |||||||| ||||| |||||||||| | |||| |||||||| |||||||||||||| |
|
|
| T |
47635054 |
gaggtcctggattcgaacccaggtcacaatgtccgaccttgcaattccaaaatttaccagttgaattaggacttctagac |
47635133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 95
Target Start/End: Complemental strand, 24751824 - 24751758
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggactt |
95 |
Q |
| |
|
|||||||||||| | ||| || |||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
24751824 |
gggttcgaaccccgatcatgacatccggcctaacaatttcggcattttgccagttgagctaggactt |
24751758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 28171036 - 28171105
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt--gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28171036 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcatttttgccagttgagctaggacttct |
28171105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 95
Target Start/End: Original strand, 29212122 - 29212188
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggactt |
95 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
29212122 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggactt |
29212188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 40840240 - 40840171
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt--gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40840240 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcatttttgccagttgagctaggacttct |
40840171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 98
Target Start/End: Complemental strand, 53182794 - 53182736
Alignment:
| Q |
40 |
ccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttcta |
98 |
Q |
| |
|
|||| |||||||||| | |||||||||||| |||||||||||||| ||| | ||||||| |
|
|
| T |
53182794 |
ccggatcacaacgtctgaccttgcaatttcagcatttgccagttgtgctcgaacttcta |
53182736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 100
Target Start/End: Complemental strand, 1242254 - 1242217
Alignment:
| Q |
64 |
aatttcggcattt-gccagttgagctaggacttctaga |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1242254 |
aatttcggcattttgccagttgagctaggacttctaga |
1242217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Complemental strand, 2687607 - 2687562
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2687607 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
2687562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Original strand, 6583315 - 6583360
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6583315 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
6583360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 4976765 - 4976833
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
4976765 |
gggttcgaaccccggtcatggcatccggcctaacaattttggcattttgccagttgagctaggacttct |
4976833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 24650604 - 24650672
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| |||||||||| |||||||||| |
|
|
| T |
24650604 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgaggtaggacttct |
24650672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 58 - 98
Target Start/End: Original strand, 31305828 - 31305868
Alignment:
| Q |
58 |
ccttgcaatttcggcatttgccagttgagctaggacttcta |
98 |
Q |
| |
|
||||||||||||| ||||||||| |||||||| |||||||| |
|
|
| T |
31305828 |
ccttgcaatttcgacatttgccaattgagctaagacttcta |
31305868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 32961035 - 32961103
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | || ||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32961035 |
gggttcgaaccccggtcatggcatctggcctaacaatttcggcattttgccagttgagctaggacttct |
32961103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 34397751 - 34397683
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||| | || |||||||| |||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
34397751 |
gggttcgaaccccggttatgacatccggcctaacaatttcggcattttgccagttgaactaggacttct |
34397683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 41464735 - 41464667
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||| ||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41464735 |
gggttcgaaccccggtcatggcatccgacctaacaatttcggcattttgccagttgagctaggacttct |
41464667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 47410809 - 47410877
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||| ||| |||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
47410809 |
gggttcgaaccccggtcatgacatccgacctaacaatttcgacattttgccagttgagctaggacttct |
47410877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 77; Significance: 1e-35; HSPs: 73)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 18 - 102
Target Start/End: Original strand, 19849548 - 19849632
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19849548 |
ctgtgaggtcccgggttcgaacccggatcacgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
19849632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 18 - 102
Target Start/End: Complemental strand, 34739363 - 34739279
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34739363 |
ctgtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
34739279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 45874138 - 45874055
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
45874138 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaattttggcatttgtcagttgagctaggacttctagac |
45874055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 1174034 - 1173951
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1174034 |
ctgtgaggtcccgggttcgaacccaggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
1173951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 28798433 - 28798516
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28798433 |
ctgtaaggtcccgggttcgaacccgggtcacgacgtccggccttgcaatttcggcatttgccagttgaactaggacttctagac |
28798516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 43139951 - 43140034
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43139951 |
ctgtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctagaacttctagac |
43140034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 54768477 - 54768560
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54768477 |
ctgtgaggtcctgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
54768560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 18 - 102
Target Start/End: Original strand, 26424903 - 26424986
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26424903 |
ctgtgaggtcccgggttcgaacccgggtcatgacgtccg-ccttgcaatttcggcatttgccagttgagctaggacttctagact |
26424986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 11278065 - 11277982
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||||| |||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11278065 |
ctgtgaggtcccgggtttgaacccgggtcatgatgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
11277982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 18257412 - 18257329
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||| |||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18257412 |
ctgtgaggtcccgggctcgaacccggatcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
18257329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 53457907 - 53457824
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53457907 |
ctgtgaggtcccggattcgaacccgggtcatgacgtccgaccttgcaatttcggcatttgccagttgagctaggacttctagac |
53457824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 18 - 98
Target Start/End: Complemental strand, 22608068 - 22607988
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttcta |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| || |||||||||||||||||||| |
|
|
| T |
22608068 |
ctgtgaggtcccgggttcgaacccgggtcacgacgtccggccttgcaatttcgacatctgtcagttgagctaggacttcta |
22607988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 25 - 93
Target Start/End: Original strand, 23417535 - 23417603
Alignment:
| Q |
25 |
gtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggac |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23417535 |
gtcccgggttcgaacccgggtcacaacgtccggccttgcaattttggcatttgccagttgagctaggac |
23417603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 18 - 102
Target Start/End: Original strand, 32441129 - 32441213
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32441129 |
ctgtgaggtcccgggttcgaacccgggtcatgatgtctggccttgcaatttcgacatttgccagttgagctaggacttctagact |
32441213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 18 - 102
Target Start/End: Complemental strand, 55214735 - 55214651
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |||||||| || |||||||||||| |
|
|
| T |
55214735 |
ctgtgaggtcccgggttcgaacccgggtcacgacgtccggccttgcaattttggcatttgacagttgagttaagacttctagact |
55214651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 19 - 99
Target Start/End: Complemental strand, 19225341 - 19225261
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctag |
99 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19225341 |
tgtgaggtcccgggttcgaacccggatcatgacgtccggctttacaatttcggcatttgccagttgagctaggacttctag |
19225261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 238503 - 238586
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
238503 |
ctgtgaggtcccgggttcgaacccaggtcatggcgtccagccttgcaatttcggcatttgacagttgagctaggacttctagac |
238586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 12735514 - 12735431
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||||| |||||| |||||||| |||||||||||| |||||||||| |
|
|
| T |
12735514 |
ctgtgaggtcctgggttcgaacccgggtcacaacgtctggccttacaattttggcatttgtcagttgagctagtacttctagac |
12735431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 19673975 - 19674057
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
19673975 |
tgtgaggtcccgggttcgaacccaggtcacaacgttcggccttgcaatttctacatttaccagttgagctaagacttctagac |
19674057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 12867924 - 12867841
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||| |||| ||||||||| |||||||| ||||||| |||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
12867924 |
ctgtgagatcccaggttcgaactcgggtcacgacgtccgaccttgcaatttcggcatttgacagttgagctagaacttctagac |
12867841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 23710378 - 23710461
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||| || |||||||| ||||||||| ||||||||||||||||||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
23710378 |
ctgtgaggttccaggttcgaatccgggtcacgacgtccggccttgcaatttcgacatttaccagttgagctatgacttctagac |
23710461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 31 - 101
Target Start/End: Original strand, 2864806 - 2864876
Alignment:
| Q |
31 |
ggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
2864806 |
ggttcgaacccgggtcacgacgtcccgccttgcaatttaggcatttgccagttgagttaggacttctagac |
2864876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 21 - 98
Target Start/End: Complemental strand, 3465832 - 3465755
Alignment:
| Q |
21 |
tgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttcta |
98 |
Q |
| |
|
|||||||||| ||||||||| || |||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
3465832 |
tgaggtcccgagttcgaacctggatcacaacgtccggccttgcaatttcgatatttgctagttgagctaggacttcta |
3465755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 19 - 98
Target Start/End: Complemental strand, 19814187 - 19814108
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttcta |
98 |
Q |
| |
|
||||||||||| |||| |||||| |||||| |||||||||||| ||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
19814187 |
tgtgaggtcccaggtttgaacccaggtcacgacgtccggccttacaatttctgcatttgccagttgagctaagacttcta |
19814108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 18 - 97
Target Start/End: Original strand, 29581088 - 29581167
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||| |||||||||||| |||||| ||||||||||||||||||||||||| || || |||||||||||||||| |
|
|
| T |
29581088 |
ctgtgaggtctcgggttcgaacctaggtcacgacgtccggccttgcaatttcggcatctgacaattgagctaggacttct |
29581167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 21 - 102
Target Start/End: Complemental strand, 55400308 - 55400227
Alignment:
| Q |
21 |
tgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||||| ||| ||||||| |||| ||| ||||||||||||||||||||||||||| ||||||||| ||||| ||||||||| |
|
|
| T |
55400308 |
tgaggttccgagttcgaatccggatcatgacgtccggccttgcaatttcggcatttaccagttgagttaggatttctagact |
55400227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 102
Target Start/End: Original strand, 22910302 - 22910386
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||| |||| |||||||||||||||||| ||||||| ||||||||||||| | |||| ||||||||| |||||||||||| |
|
|
| T |
22910302 |
ctgtgagatcccaggttcgaacccgggtcacgacgtccgaccttgcaatttcgacttttgtcagttgagcggagacttctagact |
22910386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 102
Target Start/End: Complemental strand, 22968220 - 22968136
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||| |||| |||||||||||||||||| ||||||| ||||||||||||| | |||| ||||||||| |||||||||||| |
|
|
| T |
22968220 |
ctgtgagatcccaggttcgaacccgggtcacgacgtccgaccttgcaatttcgacttttgtcagttgagcggagacttctagact |
22968136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 29 - 101
Target Start/End: Complemental strand, 37134120 - 37134048
Alignment:
| Q |
29 |
cgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||| ||| || |||| ||||| |||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
37134120 |
cgggttcgaacccggatcatgacatccgaccttgtaatttcagcatttgccagttgaactaggacttctagac |
37134048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 12767170 - 12767087
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||| ||| ||||||||| | ||| ||||||| ||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12767170 |
ctgtgaggtttcggattcgaacccagatcatgacgtccgatcttacaatttcggcatttaccagttgagctaggacttctagac |
12767087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 32778207 - 32778125
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||| || |||||||||||| |||| ||||||| ||||||||||| || ||||| ||||||| ||| || |||||||| |
|
|
| T |
32778207 |
tgtgaggtctcgtgttcgaacccggatcacgacgtccgaccttgcaattttggtatttgtcagttgatctatgatttctagac |
32778125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 30 - 92
Target Start/End: Original strand, 39284632 - 39284694
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctagga |
92 |
Q |
| |
|
|||||||||||| ||||| || |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39284632 |
gggttcgaaccccggtcatgacatccggcctaacaatttcggcatttgccagttgagctagga |
39284694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 18 - 76
Target Start/End: Complemental strand, 39807927 - 39807869
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt |
76 |
Q |
| |
|
||||||||||||| |||||||| |||||||| | ||| ||||||||||||||||||||| |
|
|
| T |
39807927 |
ctgtgaggtcccgagttcgaactcgggtcacgatgtctggccttgcaatttcggcattt |
39807869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 3848875 - 3848943
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3848875 |
gggttcgaaccccggtcatggcatccggcctagcaatttcggcattttgccagttgagctaggacttct |
3848943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 5396997 - 5397065
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5396997 |
gggttcgaaccccggtcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttct |
5397065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 9569546 - 9569478
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9569546 |
gggttcgaaccccggtcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttct |
9569478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 42154195 - 42154263
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42154195 |
gggttcgaaccccggtcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttct |
42154263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 100
Target Start/End: Original strand, 1033506 - 1033577
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1033506 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttctaga |
1033577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 100
Target Start/End: Original strand, 47462093 - 47462164
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47462093 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttctaga |
47462164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 32 - 86
Target Start/End: Complemental strand, 50033451 - 50033396
Alignment:
| Q |
32 |
gttcgaacccgggtcacaacgtcc-ggccttgcaatttcggcatttgccagttgag |
86 |
Q |
| |
|
|||||||||||||||||||||||| | | |||||||||||||||||| |||||||| |
|
|
| T |
50033451 |
gttcgaacccgggtcacaacgtccagtctttgcaatttcggcatttgacagttgag |
50033396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 31 - 84
Target Start/End: Complemental strand, 2804592 - 2804539
Alignment:
| Q |
31 |
ggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttg |
84 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||| ||||||| |||||| |
|
|
| T |
2804592 |
ggttcgaacccgggtcacaacgtccgaccttacaattttagcatttgtcagttg |
2804539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 21 - 98
Target Start/End: Complemental strand, 23858558 - 23858481
Alignment:
| Q |
21 |
tgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttcta |
98 |
Q |
| |
|
|||||||| | |||||||||||| ||||||| | ||||||| |||||| |||||| |||||||||||||| ||||| |
|
|
| T |
23858558 |
tgaggtcctgagttcgaacccggatcacaacttacggccttacaattttaacatttgtcagttgagctaggaattcta |
23858481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 31 - 80
Target Start/End: Original strand, 49030796 - 49030845
Alignment:
| Q |
31 |
ggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgcca |
80 |
Q |
| |
|
||||||||| ||| |||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
49030796 |
ggttcgaactcggatcacgacgtccggccttgcaatttcgacatttgcca |
49030845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 12821236 - 12821168
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12821236 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
12821168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 29 - 77
Target Start/End: Original strand, 24518039 - 24518087
Alignment:
| Q |
29 |
cgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttg |
77 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||| ||||||| ||||||| |
|
|
| T |
24518039 |
cgggttcgaacacgggtcacaacgtccggtcttacaatttcagcatttg |
24518087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 24712159 - 24712091
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||| ||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24712159 |
gggttcgaaccccggtcatgacatccgacctaacaatttcggcattttgccagttgagctaggacttct |
24712091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 35828345 - 35828277
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35828345 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
35828277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 95
Target Start/End: Complemental strand, 46343400 - 46343333
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggca--tttgccagttgagctaggactt |
95 |
Q |
| |
|
|||||||||||| ||||| ||||||||||| ||||||||||| |||| ||||||||||||||||| |
|
|
| T |
46343400 |
gggttcgaaccccggtcatgacgtccggcctaacaatttcggcacttttgtcagttgagctaggactt |
46343333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 46488174 - 46488242
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
||||| |||||| ||||| || |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46488174 |
gggtttgaaccccggtcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttct |
46488242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 53 - 100
Target Start/End: Original strand, 54907972 - 54908020
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
54907972 |
tccggcctaacaatttcggcattttgccagttgagctaggacttctaga |
54908020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 18 - 69
Target Start/End: Original strand, 24417923 - 24417974
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttc |
69 |
Q |
| |
|
|||||||||| ||| |||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
24417923 |
ctgtgaggtctcggattcgaacccgggtcacgacgtcgtgccttgcaatttc |
24417974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 95
Target Start/End: Complemental strand, 24870667 - 24870601
Alignment:
| Q |
31 |
ggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt--gccagttgagctaggactt |
95 |
Q |
| |
|
|||||||||| ||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
24870667 |
ggttcgaacctcggtcattacgtccggcctaacaatttcggcatttttgccagttgagctaggactt |
24870601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 96
Target Start/End: Complemental strand, 37166209 - 37166142
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttc |
96 |
Q |
| |
|
|||||||||||| | ||| || |||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
37166209 |
gggttcgaaccccgatcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttc |
37166142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 23 - 77
Target Start/End: Original strand, 16342799 - 16342853
Alignment:
| Q |
23 |
aggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttg |
77 |
Q |
| |
|
||||||||| || ||| ||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
16342799 |
aggtcccggatttgaatccgaatcacgacgtccggccttgcaatttcggcatttg |
16342853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 64 - 98
Target Start/End: Original strand, 39800614 - 39800648
Alignment:
| Q |
64 |
aatttcggcatttgccagttgagctaggacttcta |
98 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
39800614 |
aatttcggcatttgtcagttgagctaggacttcta |
39800648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Original strand, 23974722 - 23974767
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23974722 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
23974767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Original strand, 30044664 - 30044709
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30044664 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
30044709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 90
Target Start/End: Complemental strand, 34684273 - 34684212
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggca-tttgccagttgagctag |
90 |
Q |
| |
|
|||||||||||| ||||| || |||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
34684273 |
gggttcgaaccccggtcatgacatccggcctaacaatttcggcattttgccagttgagctag |
34684212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Complemental strand, 42856611 - 42856566
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42856611 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
42856566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Complemental strand, 49535933 - 49535888
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49535933 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
49535888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 97
Target Start/End: Original strand, 49882789 - 49882834
Alignment:
| Q |
53 |
tccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49882789 |
tccggcctaacaatttcggcattttgccagttgagctaggacttct |
49882834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 1982632 - 1982564
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
||||| |||||| ||||| || | |||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1982632 |
gggtttgaaccccggtcatgacatacggcctaacaatttcggcattttgccagttgagctaggacttct |
1982564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 98
Target Start/End: Complemental strand, 2075588 - 2075509
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttcta |
98 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||| ||||||||||| | ||||| |||||||| ||||| ||||| |
|
|
| T |
2075588 |
ctgtgaggtcccgggttcgaacccaaatcatgacgtccgcccttgcaattt-gatatttggcagttgaggtaggatttcta |
2075509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 6487917 - 6487852
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| |||||| || |||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
6487917 |
gggttcgaaccccggtcacgacatccggcctaacaatttcggcattt--tggttgagctaggacttct |
6487852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 7512838 - 7512770
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
7512838 |
gggttcgaaccccggtcatggcatccggcctaacaattttggcattttgccagttgagctaggacttct |
7512770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 13389091 - 13389023
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||| ||| ||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
13389091 |
gggttcgaaccccggtcatgacatccgacctaacaatttcagcattttgccagttgagctaggacttct |
13389023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 18813441 - 18813373
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
||||||||| || ||||| || |||||||| |||||||||||||| |||||||||| |||||||||| |
|
|
| T |
18813441 |
gggttcgaagcccggtcatgacatccggcctaacaatttcggcattttgccagttgagttaggacttct |
18813373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 38 - 95
Target Start/End: Original strand, 21156020 - 21156079
Alignment:
| Q |
38 |
acccgggtcacaacgtccggccttgcaatttcggcattt--gccagttgagctaggactt |
95 |
Q |
| |
|
|||| |||||| ||||| |||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21156020 |
accccggtcacggcgtccagcctagcaatttcggcatttttgccagttgagctaggactt |
21156079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 24550884 - 24550816
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| | ||| || |||||||| |||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
24550884 |
gggttcgaaccccgatcatgacatccggcctaacaatttcggcattttgccagttgagctaagacttct |
24550816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 29428126 - 29428058
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| | ||| || |||||||| ||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
29428126 |
gggttcgaaccccgatcatgacatccggcctaacaatttcggtattttgccagttgagctaggacttct |
29428058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 29648835 - 29648767
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| || |||||||| ||| |||||||||| || |||||||||||||||||| |
|
|
| T |
29648835 |
gggttcgaaccctggtcatgacatccggcctaacaaattcggcattttgctagttgagctaggacttct |
29648767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 37050772 - 37050704
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
37050772 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaagacttct |
37050704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 44 - 100
Target Start/End: Complemental strand, 41679431 - 41679375
Alignment:
| Q |
44 |
gtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctaga |
100 |
Q |
| |
|
||||| ||||||| ||||| |||||| ||||||| |||||||||||| |||| |||| |
|
|
| T |
41679431 |
gtcacgacgtccgaccttgtaatttcagcatttgtcagttgagctagaacttttaga |
41679375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1348 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: scaffold1348
Description:
Target: scaffold1348; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 907 - 990
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
907 |
ctgtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 13996 - 14079
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13996 |
ctgtgaggtcccgggttcgaacccggatcacaacgtccggccttgcaatttcggtatttgccagttgagctaggacttctagac |
14079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 19676 - 19759
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19676 |
ctgtgaggtcccgggttcgaacccggatcacaacgtccggccttgcaatttcggtatttgccagttgagctaggacttctagac |
19759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 21 - 101
Target Start/End: Original strand, 10021 - 10101
Alignment:
| Q |
21 |
tgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10021 |
tgaggtcccgggttcgaacccgggttacgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
10101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 19 - 103
Target Start/End: Complemental strand, 114334 - 114250
Alignment:
| Q |
19 |
tgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagactg |
103 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
114334 |
tgtgaggtcccgggttcgaacccggatcatgacgtccggccttacaatttcggcatttgccagttgagctaggacttctagactg |
114250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0360 (Bit Score: 57; Significance: 9e-24; HSPs: 1)
Name: scaffold0360
Description:
Target: scaffold0360; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 18 - 102
Target Start/End: Complemental strand, 14578 - 14494
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||||| ||| || |||||||||| |||||| |
|
|
| T |
14578 |
ctgtgaggtcccgggttcgaacccggatcacgacgtccggccttgcaatttcgacatttgtcagctgtgctaggacttatagact |
14494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0067 (Bit Score: 57; Significance: 9e-24; HSPs: 1)
Name: scaffold0067
Description:
Target: scaffold0067; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 22 - 102
Target Start/End: Complemental strand, 34897 - 34817
Alignment:
| Q |
22 |
gaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||| || ||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34897 |
gaggtcctggattcgaacccatgtcacgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctggact |
34817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0053 (Bit Score: 57; Significance: 9e-24; HSPs: 1)
Name: scaffold0053
Description:
Target: scaffold0053; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 22246 - 22174
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctag |
90 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
22246 |
ctgtgaggtcccgggctcgaacccgggtcacgacgtccggccttacaatttcggcatttgtcagttgagctag |
22174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0495 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0495
Description:
Target: scaffold0495; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 21 - 101
Target Start/End: Original strand, 3259 - 3339
Alignment:
| Q |
21 |
tgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
101 |
Q |
| |
|
|||||||||||||||||||||| ||||| | |||| || ||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3259 |
tgaggtcccgggttcgaacccgtgtcacgaagtccagctttgtaatttcggaatttgccagttgagctaggacttctagac |
3339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: scaffold0352
Description:
Target: scaffold0352; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 18 - 102
Target Start/End: Original strand, 8988 - 9072
Alignment:
| Q |
18 |
ctgtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagact |
102 |
Q |
| |
|
||||||||||| |||||||||||| ||| ||||||| ||||| |||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
8988 |
ctgtgaggtcctaggttcgaacccgaatcataacgtcccgccttacaatttcggcatttaccagttgagctagaacttctagact |
9072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0457 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0457
Description:
Target: scaffold0457; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 32 - 100
Target Start/End: Complemental strand, 6848 - 6779
Alignment:
| Q |
32 |
gttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||||||||| ||||| || |||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6848 |
gttcgaaccccggtcatgacatccggcctaacaatttcggcattttgccagttgagctaggacttctaga |
6779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0432 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0432
Description:
Target: scaffold0432; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 9438 - 9370
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9438 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
9370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0402 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0402
Description:
Target: scaffold0402; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 1298 - 1366
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1298 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
1366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0287 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0287
Description:
Target: scaffold0287; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 1115 - 1183
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1115 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttgccagttgagctaggacttct |
1183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0778 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0778
Description:
Target: scaffold0778; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 100
Target Start/End: Complemental strand, 889 - 818
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttctaga |
100 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
889 |
gggttcgaaccccggtcatggcatccggcctaacaatttcgacattttgccagttgagctaggacttctaga |
818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0595 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0595
Description:
Target: scaffold0595; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 95
Target Start/End: Complemental strand, 416 - 350
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcat-ttgccagttgagctaggactt |
95 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
416 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcatattgccagttgagctaggactt |
350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0079 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0079
Description:
Target: scaffold0079; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 23 - 77
Target Start/End: Complemental strand, 50062 - 50008
Alignment:
| Q |
23 |
aggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttg |
77 |
Q |
| |
|
||||||||| || ||| ||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
50062 |
aggtcccggatttgaatccgaatcacgacgtccggccttgcaatttcggcatttg |
50008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0061 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0061
Description:
Target: scaffold0061; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 8916 - 8984
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
||||||||||| ||||| || |||||||| |||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
8916 |
gggttcgaacctcggtcatgacatccggcctaacaatttcggcattttgccagttgagctatgacttct |
8984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 90640 - 90572
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcattt-gccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| | ||| || || ||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
90640 |
gggttcgaaccccgatcatgacatcaggcctaacaatttcggcattttgccagttgagctaggacttct |
90572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 97
Target Start/End: Original strand, 39370 - 39438
Alignment:
| Q |
30 |
gggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttg-ccagttgagctaggacttct |
97 |
Q |
| |
|
|||||||||||| ||||| | |||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
39370 |
gggttcgaaccccggtcatggcatccggcctaacaatttcggcattttaccagttgagctaggacttct |
39438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University