View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10367_high_15 (Length: 319)
Name: NF10367_high_15
Description: NF10367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10367_high_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 17 - 211
Target Start/End: Complemental strand, 31907579 - 31907385
Alignment:
| Q |
17 |
taactaaacatcatagaatgtaaccaaactaatagaaaacatatggttgaaaatataaaatttcaattttcagctacaaaatgacaataccaaacaagag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31907579 |
taactaaacatcatagaatgtaaccaaactaatagaaaacatatggttgaaaatataaaatttcaattttcagctacaaaatgacaataccaaacaagag |
31907480 |
T |
|
| Q |
117 |
taattcatagagatactcctccacagaacctatatagcaacttctaacttcacacataaaagcctttcaaactcatcattttaaattttgaactg |
211 |
Q |
| |
|
|||| ||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31907479 |
taatccatagagatactcttccacacaacctatatagcaacttctaacttcacacataaaagcctttcaaactcatcattttaaattttaaactg |
31907385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 279 - 318
Target Start/End: Complemental strand, 31907305 - 31907266
Alignment:
| Q |
279 |
ttgataatcatcatatcataatcataattataatgataat |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31907305 |
ttgataatcatcatatcataatcataattataatgataat |
31907266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University