View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10367_high_21 (Length: 305)
Name: NF10367_high_21
Description: NF10367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10367_high_21 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 15 - 305
Target Start/End: Complemental strand, 39076443 - 39076163
Alignment:
| Q |
15 |
gacatcatcattgcattgtctaaacatttacttgcactaatttgtatttaattgactaagtatatgcagctcaacaattatgcgaagaaaacactgaatg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076443 |
gacatcatcattgcattgtctaaacatttacttgcactaatttgtttttaattgactaagtatatgcagctcaacaattatgcgaagaaaacactgaatg |
39076344 |
T |
 |
| Q |
115 |
aagacttatatagttaagcaattaatgtccatgcatttagcttgttaagacaaattcatatttgttcgtgcaatcgaaaaagctttttgttcaacctgca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076343 |
aagacttatatagttaagcaattaatgtccatgcatttagcttgttaagacaaattcatatttgttcgtgcaatcgaaaaagctttttgttcaacctgca |
39076244 |
T |
 |
| Q |
215 |
cttgttttactttttcataaatgcnnnnnnnnnnnnnnnnnnnctgcggctgcaattggtcttagataaatgatgaaattgaaaatgatgg |
305 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076243 |
cttgttttactttttcataaatgc----------aaaaaaaaactgcggctgcaattggtcttagataaatgatgaaattgaaaatgatgg |
39076163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University