View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10368_low_5 (Length: 227)

Name: NF10368_low_5
Description: NF10368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10368_low_5
NF10368_low_5
[»] chr5 (1 HSPs)
chr5 (21-114)||(35786958-35787051)


Alignment Details
Target: chr5 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 21 - 114
Target Start/End: Complemental strand, 35787051 - 35786958
Alignment:
21 gtaaatggcttggtactttttcaactgctgaagatgctgctaaagcttatgatcgtgctgctattattctctatggttctagggctcagcttaa 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35787051 gtaaatggcttggtactttttcaactgctgaagatgctgctaaagcttatgatcgtgctgctattattctctatggttctagggctcagcttaa 35786958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University