View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10368_low_5 (Length: 227)
Name: NF10368_low_5
Description: NF10368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10368_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 21 - 114
Target Start/End: Complemental strand, 35787051 - 35786958
Alignment:
| Q |
21 |
gtaaatggcttggtactttttcaactgctgaagatgctgctaaagcttatgatcgtgctgctattattctctatggttctagggctcagcttaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35787051 |
gtaaatggcttggtactttttcaactgctgaagatgctgctaaagcttatgatcgtgctgctattattctctatggttctagggctcagcttaa |
35786958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University