View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10369_low_1 (Length: 340)
Name: NF10369_low_1
Description: NF10369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10369_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 15 - 324
Target Start/End: Complemental strand, 45186000 - 45185686
Alignment:
| Q |
15 |
gggtttcagatcttacgttctaagctcgtttccgcggtttcctctttccggaaccgtggagggacaaattggtcatttgggttacgtgctgccactttgg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45186000 |
gggtttcagatcttacgttctaagctcgtttccgcggtttcctctttccggaaccgtggagggacaaattggtcatttgggttacgtgctgccactgtgg |
45185901 |
T |
 |
| Q |
115 |
tattcattgtcatggtgttgataaggaggaggaagaatggtaggaggaccctcacgcccaatgagtctcgtcttatgcaaatcatcatggagaaagaagg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45185900 |
tattcattgtcatggtgttgataaggaggaggaagaatggaaggaggaccctcacgcccaatgagtctcgtcttatgcaaatcatcatggagaaagaagg |
45185801 |
T |
 |
| Q |
215 |
ggttcgtttaaactcaattcattacttttaatattgcatttca----tttannnnnnnatgtttcattacaatttcagaattttga-ttacttgtttaac |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45185800 |
ggttcgtttaaactcaattcattacttttaatattgcatttcatttttttttttttttatgtttcattacaatttcagaattttgatttacttgtttaac |
45185701 |
T |
 |
| Q |
310 |
aaattgcatttatac |
324 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
45185700 |
aaattgcatttatac |
45185686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University