View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10369_low_7 (Length: 238)
Name: NF10369_low_7
Description: NF10369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10369_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 37 - 179
Target Start/End: Complemental strand, 27538913 - 27538771
Alignment:
| Q |
37 |
taagttatatgtacacccgaggctcatttagtggtgagtcttgctatatggtacgagagatttgttgccggactcatgcacgacatactcctaaacacac |
136 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
27538913 |
taagttatatgtacacccgaggcccatttagcggtgagtcttgccatatggtacgagagatttgttgcacgactcatgcacgacatactcttaaacacac |
27538814 |
T |
|
| Q |
137 |
aatttgcttggttaatgacattcttcttgttggcttatggttt |
179 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27538813 |
aatttgcttcgttaatgacattcttcttgttggcttatggttt |
27538771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 77 - 176
Target Start/End: Complemental strand, 43398799 - 43398701
Alignment:
| Q |
77 |
ttgctatatggtacgagagatttgttgccggactcatgcacgacatactcctaaacacacaatttgcttggttaatgacattcttcttgttggcttatgg |
176 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||| || | ||||||||| |||| ||||| |||||| ||||||| ||||| |||||| |
|
|
| T |
43398799 |
ttgctatatggtacgagagatttaatgcgcgactcatgcacgacatgct-caaaacacacactttgtttggtgaatgaccttcttctagttggtttatgg |
43398701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 176
Target Start/End: Original strand, 43814419 - 43814487
Alignment:
| Q |
107 |
gactcatgcacgacatactcctaaacacacaatttgcttggttaatgacattcttcttgttggcttatgg |
176 |
Q |
| |
|
|||||||||||||||| || | ||||||||| |||| ||||| |||||| ||||||| ||||| |||||| |
|
|
| T |
43814419 |
gactcatgcacgacatgct-caaaacacacattttgtttggtgaatgaccttcttctagttggtttatgg |
43814487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 43
Target Start/End: Complemental strand, 27539353 - 27539325
Alignment:
| Q |
15 |
aacaaatgtgagaatttataaataagtta |
43 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27539353 |
aacaaatgtgagaatttataaataagtta |
27539325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 77 - 176
Target Start/End: Original strand, 29304381 - 29304479
Alignment:
| Q |
77 |
ttgctatatggtacgagagatttgttgccggactcatgcacgacatactcctaaacacacaatttgcttggttaatgacattcttcttgttggcttatgg |
176 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||| || | ||||||||| |||| ||||| |||||| ||||||| ||||| |||||| |
|
|
| T |
29304381 |
ttgctatatggtacgagagatttaatgcacgactcatgcacgacatgct-caaaacacacactttgtttggtgaatgaccttcttctagttggtttatgg |
29304479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 179
Target Start/End: Complemental strand, 12379793 - 12379745
Alignment:
| Q |
131 |
acacacaatttgcttggttaatgacattcttcttgttggcttatggttt |
179 |
Q |
| |
|
||||||| ||||| |||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
12379793 |
acacacactttgcatggtgaatgaccttcttcttgttggtttatggttt |
12379745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 77 - 176
Target Start/End: Complemental strand, 25343571 - 25343473
Alignment:
| Q |
77 |
ttgctatatggtacgagagatttgttgccggactcatgcacgacatactcctaaacacacaatttgcttggttaatgacattcttcttgttggcttatgg |
176 |
Q |
| |
|
||||||||||||||||||||||| ||| | |||||||||||||| || | ||||||||| |||| ||||| |||||| ||||||| ||||| |||||| |
|
|
| T |
25343571 |
ttgctatatggtacgagagatttaatgcacggctcatgcacgacatgct-caaaacacacactttgtttggtgaatgaccttcttctagttggtttatgg |
25343473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 77 - 176
Target Start/End: Original strand, 2090248 - 2090346
Alignment:
| Q |
77 |
ttgctatatggtacgagagatttgttgccggactcatgcacgacatactcctaaacacacaatttgcttggttaatgacattcttcttgttggcttatgg |
176 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||| ||||||| || | ||||||||| |||| ||||| |||||| |||||| ||||| |||||| |
|
|
| T |
2090248 |
ttgctatatggtacgagagatttaatgcacgactcatgtacgacatgct-caaaacacacactttgtttggtgaatgaccctcttctagttggtttatgg |
2090346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University