View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1036_low_14 (Length: 256)
Name: NF1036_low_14
Description: NF1036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1036_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 63 - 237
Target Start/End: Complemental strand, 42468438 - 42468263
Alignment:
| Q |
63 |
atgtatcctgtgactcaaactcttgacaattggaaatctcttcggggaataatacctgaacagaattaaccgtgactggtatgactgtctaatcgtcata |
162 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42468438 |
atgtatcttgtgactcgaactcttgacaattggaaatctctttggggaataatacctgaacagaattaaccgtgactggtatgactgtgtaatcgtcata |
42468339 |
T |
 |
| Q |
163 |
atgctgccagtactgtgatactt-aagaataaaaattgatgtaataaaagtgtgactctttgttgttttccacata |
237 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42468338 |
atgctgccagtactgtgatacttaaagaataaaaattgatgtaataaaagtgtgactccttgttgttttccacata |
42468263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 30 - 68
Target Start/End: Complemental strand, 42471168 - 42471130
Alignment:
| Q |
30 |
acatgtgtcctatttgttccaggctcaacagacatgtat |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42471168 |
acatgtgtcctatttgttccaggctcaacagacatgtat |
42471130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University