View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1036_low_14 (Length: 256)

Name: NF1036_low_14
Description: NF1036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1036_low_14
NF1036_low_14
[»] chr4 (2 HSPs)
chr4 (63-237)||(42468263-42468438)
chr4 (30-68)||(42471130-42471168)


Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 63 - 237
Target Start/End: Complemental strand, 42468438 - 42468263
Alignment:
63 atgtatcctgtgactcaaactcttgacaattggaaatctcttcggggaataatacctgaacagaattaaccgtgactggtatgactgtctaatcgtcata 162  Q
    ||||||| |||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
42468438 atgtatcttgtgactcgaactcttgacaattggaaatctctttggggaataatacctgaacagaattaaccgtgactggtatgactgtgtaatcgtcata 42468339  T
163 atgctgccagtactgtgatactt-aagaataaaaattgatgtaataaaagtgtgactctttgttgttttccacata 237  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||    
42468338 atgctgccagtactgtgatacttaaagaataaaaattgatgtaataaaagtgtgactccttgttgttttccacata 42468263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 30 - 68
Target Start/End: Complemental strand, 42471168 - 42471130
Alignment:
30 acatgtgtcctatttgttccaggctcaacagacatgtat 68  Q
    |||||||||||||||||||||||||||||||||||||||    
42471168 acatgtgtcctatttgttccaggctcaacagacatgtat 42471130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University