View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1036_low_16 (Length: 251)
Name: NF1036_low_16
Description: NF1036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1036_low_16 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 10 - 251
Target Start/End: Complemental strand, 53459347 - 53459106
Alignment:
| Q |
10 |
ccacagaaacagatattgcacataacacacacaatagtacttctactgttttgggaatatattttgtctccatgcatacaattgcattttcatatgaagt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53459347 |
ccacagaaacagatattgcacataacacacacaatagtacttctattgttttgggaatatattttgtctccatgcatacaattgcattttcatatgaagt |
53459248 |
T |
 |
| Q |
110 |
tggtgtaattgtattcatctttgtcacacacggacttaatttgttgcaactactagaccttcgttaagtcttgcagttaattcctttcgcagaatttttc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
53459247 |
tggtgtaattgtattcatctttgtcacacacggacttaatttgtggcaactactagaccttcgttaagtctcgcagttaattcctttcgcagaatttttc |
53459148 |
T |
 |
| Q |
210 |
ctgaggcggctttaggaattgtttctgtgaagtaaactctgt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53459147 |
ctgaggcggctttaggaattgtttctgtgaagtaaactctgt |
53459106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University