View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1036_low_8 (Length: 352)
Name: NF1036_low_8
Description: NF1036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1036_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 74; Significance: 7e-34; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 93 - 174
Target Start/End: Complemental strand, 26032388 - 26032307
Alignment:
| Q |
93 |
atggtatgaaaaggttagagactaatttagattttatttttgtcaagtactaaattggccctcacaaatacctccattttga |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26032388 |
atggtatgaaaaggttagagactaatttagattttatttttatcaagtactaaattggccctcacaaataccttcattttga |
26032307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 158 - 259
Target Start/End: Complemental strand, 26032108 - 26032009
Alignment:
| Q |
158 |
aaatacctccattttgagaagagacaatggtactaaatatttctatggaaatcacgaatagtttctccaacataaatgtattaagtatattgataaacat |
257 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
26032108 |
aaatacctccattttgaaaagcgacaatggtagtaaatatttctatggaaatcaagaatagtttctccaacataaatgtatta--tgtattgataaacat |
26032011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 278 - 323
Target Start/End: Complemental strand, 26032022 - 26031977
Alignment:
| Q |
278 |
attgataaacatgcacaaatatgtctaatggggttgacaagaccct |
323 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26032022 |
attgataaacatgcagaaatatgtctaatggggttgacaagaccct |
26031977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 9e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 11 - 74
Target Start/End: Original strand, 52477962 - 52478021
Alignment:
| Q |
11 |
acaatattcacgtgagatatatatggtatagaagaaagtcatgatatatatggccgaccagcac |
74 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52477962 |
acaatattcacgtgagatat----ggtatagaagaaagtcatgatatatatggccgaccagcac |
52478021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University