View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10370_low_1 (Length: 457)
Name: NF10370_low_1
Description: NF10370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10370_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 2e-50; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 218 - 335
Target Start/End: Complemental strand, 38387609 - 38387492
Alignment:
| Q |
218 |
cgttcaggtgaagcagttacaatatccagagacagtttttgagacaattatcggtataattattcggctagcagaacatggtctcattcattgtgatttc |
317 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38387609 |
cgttcaggtgaagcagttacaaaacccagagacagtttttgagacaattattggtataattattcggctggcagaacatggtctcattcattgtgatttc |
38387510 |
T |
|
| Q |
318 |
aatgaatttaacatcatg |
335 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
38387509 |
aatgaatttaacatcatg |
38387492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 17 - 114
Target Start/End: Complemental strand, 38389675 - 38389578
Alignment:
| Q |
17 |
agttataattggctctatttatctcgccttgctgcacttagagaatttgctttcataaaggtgcttttactctcccttgctatatacttgaaatgtta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| | ||| |||||||| ||||| |
|
|
| T |
38389675 |
agttataattggctctatttatctcgccttgctgcacttaaagaatttgctttcatgaaggtgcttttactctccctggttatgtacttgaattgtta |
38389578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 339 - 445
Target Start/End: Complemental strand, 38387361 - 38387255
Alignment:
| Q |
339 |
gacgatgaagaaaaagttaccgtgattgattttccgcaaatggtgtatgtgtcacactgtaatgcaaagatgcaagagtctcttccttgtatgctatcac |
438 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||| |||||||||| |||||| ||| |||||||||||||| ||||| ||||||||| ||| ||| | |
|
|
| T |
38387361 |
gacgatgaagaaaaaattactgtgattgattttccacaaatggtgtctgtgtcgcaccgtaatgcaaagatgtaagagcttcttccttgcatggtattat |
38387262 |
T |
|
| Q |
439 |
gtccctt |
445 |
Q |
| |
|
||||||| |
|
|
| T |
38387261 |
gtccctt |
38387255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 119 - 217
Target Start/End: Complemental strand, 38389543 - 38389445
Alignment:
| Q |
119 |
gcttaagcaggctttgcacaaacatggctttccagttccggaagctgtcgaccgtaatcgacattgtgtaatcatggcacttgttcaaggttatcctct |
217 |
Q |
| |
|
|||| ||||||||||||| | |||||||||||| ||||| || ||||| || | |||||||||||||||||||||| | ||||| |||||||||||||| |
|
|
| T |
38389543 |
gcttgagcaggctttgcaaacacatggctttcctgttccagaggctgtggaacataatcgacattgtgtaatcatgtcgcttgtccaaggttatcctct |
38389445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 117 - 215
Target Start/End: Complemental strand, 34444347 - 34444249
Alignment:
| Q |
117 |
ttgcttaagcaggctttgcacaaacatggctttccagttccggaagctgtcgaccgtaatcgacattgtgtaatcatggcacttgttcaaggttatcct |
215 |
Q |
| |
|
|||||| || |||||||||| | |||||||||| | ||||| | ||||| || | |||||||||||||||||||||| | ||||| |||||||||||| |
|
|
| T |
34444347 |
ttgcttgagtaggctttgcaaacacatggcttttcggttccacaggctgtggaacataatcgacattgtgtaatcatgtcgcttgtccaaggttatcct |
34444249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University