View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10370_low_4 (Length: 270)
Name: NF10370_low_4
Description: NF10370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10370_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 1848940 - 1848692
Alignment:
| Q |
1 |
gcttggtaaccctgagtctgatgtcggggttccattagattgttcctggactagaatagattgagcaccaacaacgagatctttgccaatgataatatca |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1848940 |
gcttggtatccctgagtctgatgtcggggttccattagattgttcctggactagaatagattgagtaccaacaacgagatctttgccaatgataatatca |
1848841 |
T |
 |
| Q |
101 |
ttggtgtttttgggatacgaaagtaggtcaccccctccagatgccaatgcagatttaactctaaacgcagcactgtgagttgaggaagatttataattca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1848840 |
ttggtgtttttgggatacgaaagtaggtcaccccctccagatgccaatgcagatttaactctaaacgcagcactgtgagttgaggaagatttataattca |
1848741 |
T |
 |
| Q |
201 |
gtttgacaagagggaaatcattgaacaatttgaagtgattggatggcct |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1848740 |
gtttgacaagagggaaatcattgaacaatttgaagtgattggatggcct |
1848692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University