View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10370_low_5 (Length: 243)
Name: NF10370_low_5
Description: NF10370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10370_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 33 - 226
Target Start/End: Complemental strand, 4308396 - 4308213
Alignment:
| Q |
33 |
gaaagaatttaaccatctagtttggtatgctttgatttagcagttcaattttctgtaaaggtagttctagtttagaaacatataatcaatgcaccaaacc |
132 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4308396 |
gaaagaatttaaccgtctagtttggtatgctttgattttgcagttcaattttctgtaaaggtagttctagt----------ataatcaatgcaccaaacc |
4308307 |
T |
|
| Q |
133 |
tttatacaagttcaattcaattttactgaactgtttcaattcacttcggttttcctttcgattcgattttccttattgaatcgaaccatgaacc |
226 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
4308306 |
tttattcaagttcaattcaattttaccgaactgtttcaattcacttcggttttcctttcgattcaattttccttattgaatcaaaccatgaacc |
4308213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University