View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10371_high_14 (Length: 261)
Name: NF10371_high_14
Description: NF10371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10371_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 17 - 245
Target Start/End: Complemental strand, 6931564 - 6931336
Alignment:
| Q |
17 |
gagagcatcctaaagactagtaccactttatagatttggtgtcatattgcaatatcactgtttccaattttcttgcaatagcttgctgttcaaggaaaag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6931564 |
gagagcatcctaaagactagtaccactttatagatttggtgtcatattgcaatatcactgtttccaattttcttgcaatagcttgctgttcaaggaaaag |
6931465 |
T |
|
| Q |
117 |
ctaattataattagttcatcatatctttgtaaattgttcacgttatgtgttaccatttgcttatatatgtagcaactttctatatctgattaaatataaa |
216 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6931464 |
ctaattataattaattcatcatttctttgtaaattgttcacgttatgtgttaccatttgcttatatatgtagcaactttctatatctgattaaatataaa |
6931365 |
T |
|
| Q |
217 |
tttaattttacagacttacagttaaaatg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6931364 |
tttaattttacagacttacagttaaaatg |
6931336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 17 - 126
Target Start/End: Original strand, 6486781 - 6486890
Alignment:
| Q |
17 |
gagagcatcctaaagactagtaccactttatagatttggtgtcatattgcaatatcactgtttccaattttcttgcaatagcttgctgttcaaggaaaag |
116 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486781 |
gagagcatcctacagactagtaccactttatagatttggtgtcttattgcaatatcactgcttccaattttcttgcaatagcttgctgttcaaggaaaag |
6486880 |
T |
|
| Q |
117 |
ctaattataa |
126 |
Q |
| |
|
|||||||||| |
|
|
| T |
6486881 |
ctaattataa |
6486890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University