View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10371_high_23 (Length: 242)
Name: NF10371_high_23
Description: NF10371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10371_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 18 - 223
Target Start/End: Original strand, 52512171 - 52512387
Alignment:
| Q |
18 |
aaaagtagtattataataaggaagaagaatattattatta-----------aaaaagaatgaggagaaaagagaagaggactcacaaatgatgttaccac |
106 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52512171 |
aaaagtagtattataataaggaagaatattattattattattattattataacaaagaatgaagagaaaagagaagaggactcacaaatgatgttaccac |
52512270 |
T |
 |
| Q |
107 |
ttccaccacaatttctgcaaccaggaggcttatcaagagcggttgctgctgagttggttgcattaattaaaaatggagttgaacacaaacatttaagaca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52512271 |
ttccaccacaatttctgcaaccaggaggcttatcaagagcggttgctgctgagttggttgcattaattaaaaatggagttgaacacaaacatttaagaca |
52512370 |
T |
 |
| Q |
207 |
ttgacgcctcgaaacaa |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
52512371 |
ttgacgcctcgaaacaa |
52512387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University