View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10371_high_31 (Length: 227)
Name: NF10371_high_31
Description: NF10371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10371_high_31 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 3604047 - 3603821
Alignment:
| Q |
1 |
gaagatatttgtgaagttgtatatgcatatcatttgtaacttctgaatataggcttaaaaacaccctctatcaagattcaagaacttgcataactgtacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3604047 |
gaagatatttgtgaagttgtatatgcatatcatttgtaacttctgaatataggcttaaaaacactctctatcaagattcaagaacttgcataactgtacg |
3603948 |
T |
|
| Q |
101 |
tgcaaggaatcattcaaaggcaatgcccgctgtagaataatggagaagacagtgtcaaaagaagggaaacgacaaatcatatgcatagctggttgagttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3603947 |
tgcaaggaatcattcaaaggcaatgcccgctgtagaataatggagaagacagtgtcaaaagaagggaaacgacaaatcatatgcatagctggttgagttt |
3603848 |
T |
|
| Q |
201 |
aaaaaacaataagtaatgcatatacct |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
3603847 |
aaaaaacaataagtaatgcatatacct |
3603821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University