View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10371_low_17 (Length: 289)
Name: NF10371_low_17
Description: NF10371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10371_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 14 - 273
Target Start/End: Original strand, 29480964 - 29481223
Alignment:
| Q |
14 |
agatgaaggaccataaatttatataatcatagctcacaggaaaatgaaactatagatttgaagaataaaaaccatatagaaatggacaatgagcaaaatt |
113 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29480964 |
agatgaaggaccataaatttatatattcatagctcacaggaaaatgaaactatagatttgaagaataaaaaccatatagaaatggacaatgagcaaaatt |
29481063 |
T |
 |
| Q |
114 |
tatataagataaaagagatagagtaattatacccgtcgaaatgccacccggtcaagttagctacttgagatagagcagttttccatttaagcactttctc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29481064 |
tatataagataaaagagatagagtaattatacccgtcgaaatgccacccgggcaagttagctacttgagatagagcggttttccatttaagcactttctc |
29481163 |
T |
 |
| Q |
214 |
cttgttttcatggaacctctcctcgtgctttacgaatgcagcttcaaaaggtccactttg |
273 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29481164 |
cctgttttcatggaacctctcctcgtgctttacgaatgcagcttcaaaaggtccactttg |
29481223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University