View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10371_low_18 (Length: 266)
Name: NF10371_low_18
Description: NF10371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10371_low_18 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 17 - 266
Target Start/End: Original strand, 5531726 - 5531974
Alignment:
| Q |
17 |
aacaacaatgtatcacacatttaaggaccgaaatgaatgattattgcctacatatttcgagaaaactgtcatttttgttctttaatgtgtcaagcaagtc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5531726 |
aacaacaatgtatcacacatttaaggaccgaaatgaatgattattgcctacatattt-gagaaaaccgtcatttttgttctttaatgtgtcaagcaagtc |
5531824 |
T |
 |
| Q |
117 |
cttgatgtgtcaaaattacaaaacatgatgtgtctttgctaagtgagtttggtccttgaatgtatctttcattagttaatttgatcctcaaatatatctt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5531825 |
cttgatgtgtcaaaattacaaaacatgatgtgtctttgctaagtgagtttggtccttgaatgtatctttcattagttagtttgatcctcaaatatatctt |
5531924 |
T |
 |
| Q |
217 |
tcgttggtcaaattaattagtccataaaattacagacaaaagatacactt |
266 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
5531925 |
tcgttggtcaaattaattaatccataaaattacggacaaaagatacactt |
5531974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 144 - 202
Target Start/End: Original strand, 15316556 - 15316614
Alignment:
| Q |
144 |
atgtgtctttgctaagtgagtttggtccttgaatgtatctttcattagttaatttgatc |
202 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15316556 |
atgtgtctttccttggtgagtttggtccttgaatgtatctttcattagttaatttgatc |
15316614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 144 - 226
Target Start/End: Original strand, 12544814 - 12544896
Alignment:
| Q |
144 |
atgtgtctttgctaagtgagtttggtccttgaatgtatctttcattagttaatttgatcctcaaatatatctttcgttggtca |
226 |
Q |
| |
|
|||||||||| || |||| ||||||| || ||||||||||| |||||||| ||||||| | ||| ||||||||||| |||| |
|
|
| T |
12544814 |
atgtgtcttttcttagtgtgtttggttctcaaatgtatcttttattagttagtttgatctttgaatgtatctttcgttagtca |
12544896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University