View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10371_low_21 (Length: 250)
Name: NF10371_low_21
Description: NF10371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10371_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 32914978 - 32914741
Alignment:
| Q |
1 |
ttatgataatgatgagataactaaccattgtgttgctagtggaaaagtgtcacatgtggtttatggtctctagcgatctatgaagcacatgtatgtaatc |
100 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32914978 |
ttatgataatgattagataactagccattgtgttgctagtggaaaagtgttacatgtggtttattgtctctagcgatctatgaagcacatgtatctaatc |
32914879 |
T |
 |
| Q |
101 |
ctcggattaggcgtgtttagatgtcagatatgtaacatatctgacaccaatacatgattccaataaatcatgtcagttttttaataatgtcattttnnnn |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32914878 |
ttcggatcaggcgtgtttagatgtcagatatgtaacatatccgacaccaacacatgattccaataaatcatgtcagttttttaataatgtcattttttaa |
32914779 |
T |
 |
| Q |
201 |
nnnntattttccgtgttaaattatttgtgtcgtgtctg |
238 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||| |
|
|
| T |
32914778 |
aaattattttctgtgtcaaattatttgtgtcgtgtctg |
32914741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 155
Target Start/End: Complemental strand, 17155597 - 17155541
Alignment:
| Q |
99 |
tcctcggattaggcgtgtttagatgtcagatatgtaacatatctgacaccaatacat |
155 |
Q |
| |
|
|||||| ||||| |||||| |||||| |||||||| ||||||||||||| |||||| |
|
|
| T |
17155597 |
tcctcgtattagatgtgttttgatgtcggatatgtatcatatctgacaccgatacat |
17155541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University