View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10371_low_23 (Length: 250)
Name: NF10371_low_23
Description: NF10371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10371_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 11 - 215
Target Start/End: Complemental strand, 34908666 - 34908466
Alignment:
| Q |
11 |
aagcatccaaaacataaaaattcatatttaaatcagcgttgtttgaaaattcaannnnnnnaagaaatttttctaatattctaacatgattgccacaaaa |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34908666 |
aagcattcaaaacataaaaattcatatttaaatcagcgttgtttgaaaattcaatttttttaagaaaattttctaatattctaacatgattgccacaaag |
34908567 |
T |
 |
| Q |
111 |
cttaaaatatcaatgatacacatttgttctcttcttattttgaaagaagaatcacactcaccaaccaacattcgagaaatgtcttgacgtttccacaact |
210 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34908566 |
cttaaaatgtcaatgatacacatttgttttcttcttattttgaaagaagaatcacactcac----caacattcgagaaatgtcttgacttttccacaact |
34908471 |
T |
 |
| Q |
211 |
tccac |
215 |
Q |
| |
|
||||| |
|
|
| T |
34908470 |
tccac |
34908466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University