View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10371_low_30 (Length: 241)
Name: NF10371_low_30
Description: NF10371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10371_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 62 - 239
Target Start/End: Complemental strand, 29554845 - 29554668
Alignment:
| Q |
62 |
ttggtgaaatagcacctcaccaactaagttgctttttattattaaacaaataagtagcgggtaaatttcggtaccaatcctctatctctaactttttagg |
161 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29554845 |
ttggttaaatagcacctcaccaactaagttgctttttattattaaacaaataagtagcgggtaaatttcggtaccaatcctctatctctaactttttagg |
29554746 |
T |
|
| Q |
162 |
cccatccgttgaccataaaacataaaattgaatgttgaatttgttgggaaatattgtgtataccaaaatagaaagaaa |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29554745 |
cccatccgttgaccttaaaacataaaattgaatgttgaatttgttgggaaatattgtgtataccaaaagagaaagaaa |
29554668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 46
Target Start/End: Complemental strand, 29554872 - 29554844
Alignment:
| Q |
18 |
cttatcaatagactgatagatggtttatt |
46 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29554872 |
cttatcaatagactgatagatggtttatt |
29554844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University