View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10371_low_35 (Length: 238)
Name: NF10371_low_35
Description: NF10371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10371_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 3603810 - 3603586
Alignment:
| Q |
1 |
aatatctaagtaacctaatcgtatctaatacaatctgcaacacattatattattcatatttaga--gattacctacacaatctaatttaaaaattctact |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
3603810 |
aatatctaagtaacctaatcgtatctaatacaatctgcaacacattatattattcatatttagactgattacctacacaatctaatttaaaaatgctact |
3603711 |
T |
|
| Q |
99 |
gttgaacaattagtgtaatttcttgggacagatctcagaggcatccttgatgattgggcttctaaaaatattagggtctcaaatannnnnnnagatttat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3603710 |
gttgaacaattagtgtaatttcttgggacagatctcagaggcatccttgatgattgggcttctaaaaatattagggtctcaaatatttttttagatttat |
3603611 |
T |
|
| Q |
199 |
gaatgactctattaagcgtacataa |
223 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3603610 |
gaatgactctattaagcgtacataa |
3603586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University