View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10371_low_37 (Length: 231)
Name: NF10371_low_37
Description: NF10371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10371_low_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 5531975 - 5532190
Alignment:
| Q |
1 |
aaattttcttttttccaattttaatacattcgtggactataatcgcaccagcccacatattcagagaccaaaatcacaatttactcaaatatttcatatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
5531975 |
aaattttcttttttccaattttaatacattcatggactataatcgcaccggcccacatattcagagaccaaaatcacgatttactcaaatatttcacatt |
5532074 |
T |
|
| Q |
101 |
tcttgaaaatcattatcacatcacgagttgtgttcagattgcagaagatcttgatttagtactcaacatacaaaggaaattcagctacctccaaaccata |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5532075 |
tcttgaaaatcattatcaaatcacgagttgtgttcagattgcagaagatcttgatttagtactcaacatacaaaggaaattcagctacctccaaaccata |
5532174 |
T |
|
| Q |
201 |
ccaggattgctttcat |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
5532175 |
ccaggattgctttcat |
5532190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University