View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10371_low_9 (Length: 390)
Name: NF10371_low_9
Description: NF10371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10371_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 6e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 164 - 376
Target Start/End: Complemental strand, 13061335 - 13061122
Alignment:
| Q |
164 |
tcatgttgtgttcttctaattttttattccatgtgtgtgagtttgtggggtttctttgttgagttcttattgatgataaaggtgatgacttattaatttc |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
13061335 |
tcatgttgtgttcttctaattttttattccatgtgtgtgagtttgtgggatttctttgttgagtgcttattga-gataaaggtgatgacttattaatttc |
13061237 |
T |
|
| Q |
264 |
ttagattgaaatgtttttt--gtgatttgtagaaattgggatttgaatgagcaaaatgaaatgaaaaaatgggttgctaggtttttcnnnnnnntaagta |
361 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
13061236 |
ttagattgaaatgttttttttgtgatttgtagaaattgggatttgaatgagcaaaatggaatgaaaaaatgggttgctaggtttttcaaaaaaataagta |
13061137 |
T |
|
| Q |
362 |
caagaatgaagattt |
376 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
13061136 |
caagaatgaagattt |
13061122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 13 - 76
Target Start/End: Complemental strand, 13061486 - 13061423
Alignment:
| Q |
13 |
caattttcattttcttcccaaatctaaatattttaatattaactaaagacataaaaagaagatt |
76 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13061486 |
caattttcattttcttcctaaatctaaatattttaatattaactaaagacataaaaagaagatt |
13061423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University