View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10373_high_13 (Length: 237)
Name: NF10373_high_13
Description: NF10373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10373_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 18 - 191
Target Start/End: Complemental strand, 18788988 - 18788815
Alignment:
| Q |
18 |
ggaggtactttttgaagtcatgaagttcaattcatctatacattttttataaaacaaatgtcataattacgatgattttaatcttannnnnnngatgcaa |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18788988 |
ggaggtacttttagaagtcatgaagttcaattcatctatacattttttataaaacaaatgtcataattacgatgattttaatcttatttttttgatgcaa |
18788889 |
T |
|
| Q |
118 |
ttccttagttttgttttgatacaagatgattttaatctaataagatcggagtagtaatatggaatctaatttta |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
18788888 |
ttccttagttttgttttgatacaagatgattttaagctaataagatcggagtagtaataatgaatctagtttta |
18788815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University